IL18BP (NM_173044) Human Untagged Clone

CAT#: SC333306

IL18BP (untagged) - Homo sapiens interleukin 18 binding protein (IL18BP), transcript variant D

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: IL18BP
• Synonyms: IL18BPa
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_173044, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGACCATGAGACACAACTGGACACCAGACCTCAGCCCTTTGTGGGTCCTGCTCCTGTGTGCCCACGTCG
  TCACTCTCCTGGTCAGAGCCACACCTGTCTCGCAGACCACCACAGCTGCCACTGCCTCAGTTAGAAGCAC
  AAAGGACCCCTGCCCCTCCCAGCCCCCAGTGTTCCCAGCAGCTAAGCAGTGTCCAGCATTGGAAGTGACC
  TGGCCAGAGGTGGAAGTGCCACTGAATGGAACGCTGAGCTTATCCTGTGTGGCCTGCAGCCGCTTCCCCA
  ACTTCAGCATCCTCTACTGGCTGGGCAATGGTTCCTTCATTGAGCACCTCCCAGGCCGACTGTGGGAGGG
  GAGCACCAGCCGGGAACGTGGGAGCACAGGCTGGGCTGAGGGCAACCTTGCCCCCCACCCAAGAAGCCCT
  GCCCTCCAGCCACAGCAGTCCACAGCAGCAGGGTTAAGACTCAGCACAGGGCCAGCAGCAGCACAACCTT
  GA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_173044
• ORF Size: 492 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_173044.2, NP_766632.2
• RefSeq Size: 1566
• RefSeq ORF: 492
• Locus ID: 10068
• Protein Families: Druggable Genome, Secreted Protein
• Gene Summary: The protein encoded by this gene functions as an inhibitor of the proinflammatory cytokine, IL18. It binds IL18, prevents the binding of IL18 to its receptor, and thus inhibits IL18-induced IFN-gamma production, resulting in reduced T-helper type 1 immune responses. This protein is constitutively expressed and secreted in mononuclear cells. Elevated level of this protein is detected in the intestinal tissues of patients with Crohn's disease. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Feb 2011]
  Transcript Variant: This variant (D) differs in the 5' UTR and uses an alternate donor splice site at the penultimate coding exon compared to variant A. This results in a frame-shift and a shorter isoform (d, also known as IL-18BPd) with a distinct C-terminus compared to isoform a. This isoform lacks the ability to bind IL-18 (PMID:10655506).