ST6GALNAC6 (NM_001287003) Human Untagged Clone
CAT#: SC333426
ST6GALNAC6 (untagged) - Human ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1, 3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6 (ST6GALNAC6), transcript variant 6
"NM_001287003" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ST6GALNAC6 |
Synonyms | SIAT7-F; SIAT7F; ST6GALNACVI |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001287003, the custom clone sequence may differ by one or more nucleotides
ATGAGTAGCAACAAAGAGCAGCGGTCAGCAGTGTTCGTGATCCTCTTTGCCCTCATCACCATCCTCATCC TCTACAGCTCCAACAGTGCCAATGAGGTCTTCCATTACGGCTCCCTGCGGGGCCGTAGCCGCCGACCTGT CAACCTCAAGAAGTGGAGCATCACTGACGGCTATGTCCCCATTCTCGGCAACAAGGGAGAAGTCTCATTC GTGGTTGAGCACAGGCTGGTTTACCATGGTGATCGCGGTGGAGTTGTGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001287003 |
ORF Size | 261 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001287003.1, NP_001273932.1 |
RefSeq Size | 2037 |
RefSeq ORF | 261 |
Locus ID | 30815 |
Protein Families | Transmembrane |
Protein Pathways | Glycosphingolipid biosynthesis - ganglio series, Metabolic pathways |
Gene Summary | ST6GALNAC6 belongs to a family of sialyltransferases that modify proteins and ceramides on the cell surface to alter cell-cell or cell-extracellular matrix interactions (Tsuchida et al., 2003 [PubMed 12668675]). [supplied by OMIM, Mar 2008] Transcript Variant: This variant (6) differs in the 5' UTR, lacks a portion of the 5' coding region, initiates translation from a downstream in-frame start codon, and lacks an exon that results in a frameshift in the 3' coding region, compared to variant 1. The encoded isoform (d) has a distinct C-terminus and is shorter than isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235532 | ST6GALNAC6 (myc-DDK-tagged) - Human ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1, 3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6 (ST6GALNAC6), transcript variant 6 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review