FRA1 (FOSL1) (NM_001300855) Human Untagged Clone
CAT#: SC333832
FOSL1 (untagged) - Human FOS-like antigen 1 (FOSL1), transcript variant 3
"NM_001300855" in other vectors (1)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | FOSL1 |
| Synonyms | FRA; fra-1; FRA1 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_001300855, the custom clone sequence may differ by one or more nucleotides
ATGTTCCGAGACTTCGGGGAACCCGGCCCGAGCTCCGGGAACGGCGGCGGGTACGGCGGCCCCGCGCAGC CCCCGGCCGCAGCGCAGGCAGCCCAGCAGAAGTTCCACCTGGTGCCAAGCATCAACACCATGAGTGGCAG TCAGGAGCTGCAGTGGATGGTACAGCCTCATTTCCTGGGGCCCAGCAGTTACCCCAGGCCTCTGACCTAC CCTCAGTACAGCCCCCCACAACCCCGGCCAGGAGTCATCCGGGCCCTGGGGCCGCCTCCAGGGGTACGTC GAAGGCCTTGTGAACAGCCCGGAGGAAGAGGAGCGCCGCCGAGTAAGGCGCGAGCGGAACAAGCTGGCTG CGGCCAAGTGCAGGAACCGGAGGAAGGAACTGACCGACTTCCTGCAGGCGGAGACTGA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001300855 |
| ORF Size | 408 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Reference Data | |
| RefSeq | NM_001300855.1, NP_001287784.1 |
| RefSeq Size | 1754 |
| RefSeq ORF | 408 |
| Locus ID | 8061 |
| Protein Families | Druggable Genome, Transcription Factors |
| Protein Pathways | Wnt signaling pathway |
| Gene Summary | The Fos gene family consists of 4 members: FOS, FOSB, FOSL1, and FOSL2. These genes encode leucine zipper proteins that can dimerize with proteins of the JUN family, thereby forming the transcription factor complex AP-1. As such, the FOS proteins have been implicated as regulators of cell proliferation, differentiation, and transformation. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014] Transcript Variant: This variant (3) uses an alternate splice junction at the 5' end of an exon compared to variant 1, that causes a frameshift. The resulting isoform (3) has a shorter and distinct C-terminus compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC235938 | FOSL1 (myc-DDK-tagged) - Human FOS-like antigen 1 (FOSL1), transcript variant 3 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China