Siglec 7 (SIGLEC7) (NM_001277201) Human Untagged Clone

CAT#: SC333926

SIGLEC7 (untagged) - Human sialic acid binding Ig-like lectin 7 (SIGLEC7), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SIGLEC7
• Synonyms: AIRM1; CD328; CDw328; D-siglec; p75; p75/AIRM1; QA79; SIGLEC-7; SIGLEC19P; SIGLECP2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001277201, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCTGCTGCTGCTGCTGCTGCCCCTGCTCTGGGGGAGGGAGAGGGTGGAAGGACAGAAGAGTAACCGGA
  AGGATTACTCGCTGACGATGCAGAGTTCCGTGACCGTGCAAGAGGGCATGTGTGTCCATGTGCGCTGCTC
  CTTCTCCTACCCAGTGGACAGCCAGACTGACTCTGACCCAGTTCATGGCTACTGGTTCCGGGCAGGGAAT
  GATATAAGCTGGAAGGCTCCAGTGGCCACAAACAACCCAGCTTGGGCAGTGCAGGAGGAAACTCGGGACC
  GATTCCACCTCCTTGGGGACCCACAGACCAAAAATTGCACCCTGAGCATCAGAGATGCCAGAATGAGTGA
  TGCGGGGAGATACTTCTTTCGTATGGAGAAAGGAAATATAAAATGGAATTATAAATATGACCAGCTCTCT
  GTGAACGTGACAGGGTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001277201
• ORF Size: 438 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001277201.1, NP_001264130.1
• RefSeq Size: 981
• RefSeq ORF: 438
• Locus ID: 27036
• Protein Families: Druggable Genome, ES Cell Differentiation/IPS, Transmembrane
• Gene Summary: Putative adhesion molecule that mediates sialic-acid dependent binding to cells. Preferentially binds to alpha-2,3- and alpha-2,6-linked sialic acid. Also binds disialogangliosides (disialogalactosyl globoside, disialyl lactotetraosylceramide and disialyl GalNAc lactotetraoslylceramide). The sialic acid recognition site may be masked by cis interactions with sialic acids on the same cell surface. In the immune response, may act as an inhibitory receptor upon ligand induced tyrosine phosphorylation by recruiting cytoplasmic phosphatase(s) via their SH2 domain(s) that block signal transduction through dephosphorylation of signaling molecules. Mediates inhibition of natural killer cells cytotoxicity. May play a role in hemopoiesis. Inhibits differentiation of CD34+ cell precursors towards myelomonocytic cell lineage and proliferation of leukemic myeloid cells (in vitro). [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (3) lacks all internal coding exons, compared to variant 1. The resulting isoform (3) is C-terminal truncated, compared to isoform 1.