RNASE4 (NM_001282193) Human Untagged Clone

CAT#: SC333938

RNASE4 (untagged) - Human ribonuclease, RNase A family, 4 (RNASE4), transcript variant 5


  "NM_001282193" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "RNASE4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RNASE4
Synonyms RAB1; RNS4
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001282193, the custom clone sequence may differ by one or more nucleotides


ATGGCTCTGCAGAGGACCCATTCATTGCTTCTGCTTTTGCTGCTGACCCTGCTGGGGCTGGGGCTGGTCC
AGCCCTCCTATGGCCAGGATGGCATGTACCAGCGATTCCTGCGGCAACACGTGCACCCTGAGGAGACAGG
TGGCAGTGATCGCTACTGCAACTTGATGATGCAAAGACGGAAGATGACTTTGTATCACTGCAAGCGCTTC
AACACCTTCATCCATGAAGATATCTGGAACATTCGTAGTATCTGCAGCACCACCAATATCCAATGCAAGA
ACGGCAAGATGAACTGCCATGAGGGTGTAGTGAAGGTCACAGATTGCAGGGACACAGGAAGTTCCAGGGC
ACCCAACTGCAGATATCGGGCCATAGCGAGCACTAGACGTGTTGTCATTGCCTGTGAGGGTAACCCACAG
GTGCCTGTGCACTTTGACGGTTAG


Restriction Sites SgfI-MluI     
ACCN NM_001282193
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001282193.1, NP_001269122.1
RefSeq Size 1746 bp
RefSeq ORF 444 bp
Locus ID 6038
Cytogenetics 14q11.2
Protein Families Secreted Protein, Transmembrane
Gene Summary 'The protein encoded by this gene belongs to the pancreatic ribonuclease family. It plays an important role in mRNA cleavage and has marked specificity towards the 3' side of uridine nucleotides. Alternative splicing results in four transcript variants encoding the same protein. This gene and the gene that encodes angiogenin share promoters and 5' exons. Each gene splices to a unique downstream exon that contains its complete coding region. [provided by RefSeq, Aug 2013]'
Transcript Variant: This variant (5) differs in the 5' UTR compared to variant 4. All four variants encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.