Centrin 3 (CETN3) (NM_001297768) Human Untagged Clone

CAT#: SC333993

CETN3 (untagged) - Human centrin, EF-hand protein, 3 (CETN3), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CETN3
• Synonyms: CDC31; CEN3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001297768, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGTTTAGCTCTGAGAAGTGAGCTTGTAGTGGACAAAACAAAGAGGAAAAAAAGAAGAGAACTGTCTG
  AGGAACAGAAACAAGAAATTAAAGATGCTTTTGAACTATTTGATACAGACAAAGATGAAGCAATAGATTA
  TCATGAATTAAAGGTGGCAATGAGAGCCTTGGGGTTTGATGTAAAAAAAGCTGATGTACTGAAGATTCTT
  AAAGATTATGACAGAGAAGCCACAGGGAAAATCACCTTTGAAGATTTTAATGAAGTTGTGACAGACTGGA
  TATTGGAAAGAGATCCCCATGAAGAAATACTCAAGGCATTTAAACTATTTGATGATGATGATTCAGTTCT
  TAAGAACATACTCTTGCTTCCTATTTGGTCTAGATGCCTCAGTCTAAATCGGGAGTTCTTCAGTGAAGTA
  AACCAAGAGGAGTTCATTGCTATTATGACTGGTGACATTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001297768
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001297768.1, NP_001284697.1
• RefSeq Size: 1332 bp
• RefSeq ORF: 462 bp
• Locus ID: 1070
• Cytogenetics: 5q14.3
• Protein Families: Druggable Genome
• Gene Summary: 'The protein encoded by this gene contains four EF-hand calcium binding domains, and is a member of the centrin protein family. Centrins are evolutionarily conserved proteins similar to the CDC31 protein of S. cerevisiae. Yeast CDC31 is located at the centrosome of interphase and mitotic cells, where it plays a fundamental role in centrosome duplication and separation. Multiple forms of the proteins similar to the yeast centrin have been identified in human and other mammalian cells, some of which have been shown to be associated with centrosome fractions. This protein appears to be one of the most abundant centrins associated with centrosome, which suggests a similar function to its yeast counterpart. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]'
  Transcript Variant: This variant (3) has an alternate splice site in the 3' coding region but maintains the reading frame, compared to variant 1. The resulting isoform (3) lacks an internal segment, compared to isoform 1.