SLAMF7 (NM_001282588) Human Untagged Clone

CAT#: SC334101

SLAMF7 (untagged) - Human SLAM family member 7 (SLAMF7), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SLAMF7
• Synonyms: 19A; CD319; CRACC; CS1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001282588, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCTGGTTCCCCAACATGCCTCACCCTCATCTATATCCTTTGGCAGCTCACAGGGTCAGCAGCCTCTG
  GACCCGTGAAAGAGCTGGTCGGTTCCGTTGGTGGGGCCGTGACTTTCCCCCTGAAGTCCAAAGTAAAGCA
  AGTTGACTCTATTGTCTGGACCTTCAACACAACCCCTCTTGTCACCATACAGCCAGAAGGGGGCACTATC
  ATAGTGACCCAAAATCGTAATAGGGAGAGAGTAGACTTCCCAGATGGAGGCTACTCCCTGAAGCTCAGCA
  AACTGAAGAAGAATGACTCAGGGATCTACTATGTGGGGATATACAGCTCATCACTCCAGCAGCCCTCCAC
  CCAGGAGTACGTGCTGCATGTCTACGAGAACAATCCTAAAGGAAGATCCAGCAAATACGGTTTACTCCAC
  TGTGGAAATACCGAAAAAGATGGAAAATCCCCACTCACTGCTCACGATGCCAGACACACCAAGGCTATTT
  GCCTATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001282588
• ORF Size: 498 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001282588.1, NP_001269517.1
• RefSeq Size: 2411
• RefSeq ORF: 498
• Locus ID: 57823
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: Isoform 3 does not mediate any NK cell activation. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) lacks three alternate exons, which results in a frameshift in the 3' coding region, compared to variant 1. The encoded isoform (b) has a distinct C-terminus and is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.