SPATA19 (NM_001291992) Human Untagged Clone

CAT#: SC334109

SPATA19 (untagged) - Human spermatogenesis associated 19 (SPATA19), transcript variant 2


  "NM_001291992" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "SPATA19"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SPATA19
Synonyms CT132; SPAS1; spergen1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001291992, the custom clone sequence may differ by one or more nucleotides


ATGATAATTACGACATGGATTGTGTATATTCTTGCTCGGAAAGGTGTAGGGCTTCCCTTCCTACCAATAA
CCAGTTCGGACATTGACGTTGTGGAAAGTGAGGCTGTGTCTGTACTACATCATTGGTTGAAAAAAACAGA
AGAAGAGGCTTCTCGGGGCATAAAGGAAAAGCTGTCCATCAACCACCCTTCCCAGGGTGTAAGGGAGAAG
ATGTCCACTGACTCCCCTCCCACCCATGGCCAGGACATCCACGTGACCAGAGATGTGGTGAAGCACCACC
TCTCTAAGTCTGATTTGTTGGCAAACCAGAGCCAAGAGGTCCTAGAGGAGAGAACACGAATCCAGTTCAT
AAGATGGAGCCACACTCGTATCTTCCAAGTGCCAAGTGAGATGACAGAGGACATCATGCGAGATCGAATA
GAGCAGGTGAGACGAAGCATATCCCGTCTTACAGATGTCTCAGCTCAGGACTTCAGTATGAGACCCTCCT
CCTCAGACTGCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001291992
ORF Size 504 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001291992.1, NP_001278921.1
RefSeq Size 793
RefSeq ORF 504
Locus ID 219938
Gene Summary May have a role in spermiogenesis. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 3' UTR compared to variant 1. Both variants 1 and 2 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.