RPE (NM_001278282) Human Untagged Clone

CAT#: SC334197

RPE (untagged) - Human ribulose-5-phosphate-3-epimerase (RPE), transcript variant 3


  "NM_001278282" in other vectors (1)

Reconstitution Protocol

USD 341.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Rabbit Polyclonal Anti-RPE Antibody - N-terminal region
    • 100 ul

USD 475.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RPE
Synonyms RPE2-1
Vector pCMV6-Entry
Sequence Data
>SC334197 representing NM_001278282.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCACATGATGGTGTCCAAGCCAGAACAGTGGGTAAAGCCAATGGCTGTAGCAGGAGCCAATCAGTAC
ACCTTTCATCTCGAGGCTACTGAGAACCCAGGGGCTTTGATTAAAGACATTCGGGAGAATGGGATGAAG
TCTTGCTCTGTCACCCAGGCTGAAGTGCAGTGGCACAGTCAGGGCCCATTGCAGGTTGGCCTTGCCATC
AAACCAGGAACCTCAGTTGAGTATTTGGCACCATGGGCTAATCAGATAGATATGGCCTTGGTTATGACA
GTGGAACCGGGGTTTGGAGGGCAGAAATTCATGGAAGATATGATGCCAAAGGTTCACTGGTTGAGGACC
CAGTTCCCATCTTTGGATATAGAGGTCGATGGTGGAGTAGGTCCTGACACTGTCCATAAATGTGCAGAG
GCAGGAGCTAACATGATTGTGTCTGGCAGTGCTATTATGAGGAGTGAAGACCCCAGATCTGTGATCAAT
CTATTAAGAAATGTTTGCTCAGAAGCTGCTCAGAAACGTTCTCTTGATCGGTGA

Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001278282
Insert Size 537 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001278282.1
RefSeq Size 3270 bp
RefSeq ORF 537 bp
Locus ID 6120
UniProt ID Q96AT9
Cytogenetics 2q34
Protein Pathways Metabolic pathways, Pentose and glucuronate interconversions, Pentose phosphate pathway
MW 19.5 kDa
Gene Summary Catalyzes the reversible epimerization of D-ribulose 5-phosphate to D-xylulose 5-phosphate.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) lacks an exon and contains two alternate exons, compared to variant 1. It initiates translation at a downstream in-frame start codon. The encoded isoform (2) is shorter and has a shorter N-terminus, compared to isoform 1. Variants 2, 3, and 4 encode the same isoform (2).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.