RPE (NM_001278282) Human Untagged Clone
CAT#: SC334197
RPE (untagged) - Human ribulose-5-phosphate-3-epimerase (RPE), transcript variant 3
"NM_001278282" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | RPE |
Synonyms | RPE2-1 |
Vector | pCMV6-Entry |
Sequence Data |
>SC334197 representing NM_001278282.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGCACATGATGGTGTCCAAGCCAGAACAGTGGGTAAAGCCAATGGCTGTAGCAGGAGCCAATCAGTAC ACCTTTCATCTCGAGGCTACTGAGAACCCAGGGGCTTTGATTAAAGACATTCGGGAGAATGGGATGAAG TCTTGCTCTGTCACCCAGGCTGAAGTGCAGTGGCACAGTCAGGGCCCATTGCAGGTTGGCCTTGCCATC AAACCAGGAACCTCAGTTGAGTATTTGGCACCATGGGCTAATCAGATAGATATGGCCTTGGTTATGACA GTGGAACCGGGGTTTGGAGGGCAGAAATTCATGGAAGATATGATGCCAAAGGTTCACTGGTTGAGGACC CAGTTCCCATCTTTGGATATAGAGGTCGATGGTGGAGTAGGTCCTGACACTGTCCATAAATGTGCAGAG GCAGGAGCTAACATGATTGTGTCTGGCAGTGCTATTATGAGGAGTGAAGACCCCAGATCTGTGATCAAT CTATTAAGAAATGTTTGCTCAGAAGCTGCTCAGAAACGTTCTCTTGATCGGTGA |
Restriction Sites | SgfI-MluI Plasmid Map |
ACCN | NM_001278282 |
Insert Size | 537 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001278282.1 |
RefSeq Size | 3270 bp |
RefSeq ORF | 537 bp |
Locus ID | 6120 |
UniProt ID | Q96AT9 |
Cytogenetics | 2q34 |
Protein Pathways | Metabolic pathways, Pentose and glucuronate interconversions, Pentose phosphate pathway |
MW | 19.5 kDa |
Gene Summary | Catalyzes the reversible epimerization of D-ribulose 5-phosphate to D-xylulose 5-phosphate.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) lacks an exon and contains two alternate exons, compared to variant 1. It initiates translation at a downstream in-frame start codon. The encoded isoform (2) is shorter and has a shorter N-terminus, compared to isoform 1. Variants 2, 3, and 4 encode the same isoform (2). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC236303 | RPE (myc-DDK-tagged) - Human ribulose-5-phosphate-3-epimerase (RPE), transcript variant 3 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review