PGAP3 (NM_001291732) Human Untagged Clone

CAT#: SC334270

PGAP3 (untagged) - Human post-GPI attachment to proteins 3 (PGAP3), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PGAP3
• Synonyms: AGLA546; CAB2; hCOS16; PERLD1; PP1498
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334270 representing NM_001291732.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGCCGGCCTGGCGGCGCGGTTGGTCCTGCTAGCTGGGGCAGCGGCGCTGGCGAGCGGCTCCCAGGGC
  GACCGTGAGCCGGTGTACCGCGACTGCGTACTGCAGTGCGAAGAGCAGAACTGCTCTGGGGGCGCTCTG
  AATCACTTCCGCTCCCGCCAGCCAATCTACATGAGTCTAGCAGGCTGGACCTGTCGGGACGACTGTAAG
  TATGAGTGTATGTGGGTCACCGTTGGGCTCTACCTCCAGGAAGGTCACAAAGTGCCTCAGTTCCATGGC
  AAGTGGCCCTTCTCCCGGTTCCTGTTCTTTCAAGAGCCGGCATCGGCCGTGGCCTCGTTTCTCAATGGC
  CTGGCCAGCCTGGTGATGCTCTGCCGCTACCGCACCTTCGTGCCAGCCTCCTCCCCCATGTACCACACC
  TGTGTGGCCTTCGCCTGGAAAATGGACTACTTCTGTGCCTCCACTGTCATCCTACACTCAATCTACCTG
  TGCTGCGTCAGCTTTCTGGAAGATGACAGCCTGTACCTGCTGAAGGAATCAGAGGACAAGTTCAAGCTG
  GACTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001291732
• Insert Size: 558 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001291732.1
• RefSeq Size: 2316 bp
• RefSeq ORF: 558 bp
• Locus ID: 93210
• UniProt ID: Q96FM1
• Cytogenetics: 17q12
• Protein Families: Transmembrane
• MW: 20.8 kDa
• Gene Summary: This gene encodes a glycosylphosphatidylinositol (GPI)-specific phospholipase that primarily localizes to the Golgi apparatus. This ubiquitously expressed gene is predicted to encode a seven-transmembrane protein that removes unsaturated fatty acids from the sn-2 position of GPI. The remodeling of the constituent fatty acids on GPI is thought to be important for the proper association between GPI-anchored proteins and lipid rafts. The tethering of proteins to plasma membranes via posttranslational GPI-anchoring is thought to play a role in protein sorting and trafficking. Mutations in this gene cause an autosomal recessive form of neurologic hyperphosphatasia with cognitive disability (HPMRS4). Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2017]
  Transcript Variant: This variant (5) lacks three in-frame exons in the 3' coding region, compared to variant 1. It encodes a shorter protein (isoform 5), compared to isoform 1.