SURF6 (NM_001278942) Human Untagged Clone

CAT#: SC334379

SURF6 (untagged) - Human surfeit 6 (SURF6), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SURF6
• Synonyms: RRP14
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334379 representing NM_001278942.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGCCTCTCTACTCGCCAAGGACGCCTACCTGCAGAGCCTGGCCAAGAAGATCTGCTCCCATTCGGCC
  CCGGAACAGCAGGCGCGCACGCGGGCTGGCAAAACTCAAGGCTCAGAAACTGCAGGGCCCCCAAAAAAG
  AAAAGGAAGAAAACACAAAAGAAATTCCGGAAGCGAGAAGAGAAGGCTGCTGAGCACAAGGCCAAGTCC
  TTGGGGGAGAAATCTCCAGCAGCCTCTGGGGCCAGGAGGCCTGAGGCAGCCAAAGAGGAAGCAGCTTGG
  GCTTCCAGCTCAGCAGGGAACCCTGCAGATGGCCTGGCCACTGAGCCTGAGTCTGTCTTTGCTCTGGAT
  GTTCTGCGACAGCGACTGCATGAGAAGATCCAGGAGGCCCGGGGCCAGGTAGTGCCAAGGAGCTGTCCC
  CTGCCGCCTTGGAGAAAAGGCGGCGGAGAAAGCAGGAACGGGACCGGAAGAAGAGGAAGCGAAAGGAGC
  TGCGGGCGAAAGAGAAGGCCAGGAAGGCTGAGGAGGCCACGGAGGCCCAGGAGGTGGTGGAGGCAACCC
  CAGAGGGGGCCTGCACGGAGCCGCGGGAGCCGCCCGGGCTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001278942
• Insert Size: 594 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001278942.1
• RefSeq Size: 2325 bp
• RefSeq ORF: 594 bp
• Locus ID: 6838
• UniProt ID: O75683
• Cytogenetics: 9q34.2
• MW: 21.8 kDa
• Gene Summary: This gene encodes a conserved protein that is localized to the nucleolus. The encoded protein may function as a nucleolar-matrix protein with nucleic acid-binding properties. There is a pseudogene for this gene on chromosome Y. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
  Transcript Variant: This variant (2) uses alternate splice sites at two coding exons, which results in a frameshift, compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1.