TCTP (TPT1) (NM_001286272) Human Untagged Clone

CAT#: SC334380

TPT1 (untagged) - Human tumor protein, translationally-controlled 1 (TPT1), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TPT1
• Synonyms: HRF; p02; p23; TCTP
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334380 representing NM_001286272.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGATTATCTACCGGGACCTCATCAGCCACGATGAGATGTTCTCCGACATCTACAAGATCCGGGAGATC
  GCGGACGGGTTGTGCCTGGAGGTGGAGGGGAAGATGGTCAGTAGGACAGAAGGTAACATTGATGACTCG
  CTCATTGGTGGAAATGCCTCCGCTGAAGGCCCCGAGGGCGAAGGTACCGAAAGCACAGTAATCACTGGT
  GTCGATATTGTCATGAACCATCACCTGCAGGAAACAAGTTTCACAAAAGAAGCCTACAAGAAGTACATC
  AAAGATTACATGAAATCAATCAAAGGGAAACTTGAAGAACAGAGACCAGAAAGAGTAAAACCTTTTATG
  ACAGGGGCTGCAGAACAAATCAAGCACATCCTTGCTAATTTCAAAAACTACCAGTTCTTTATTGGTGAA
  AACATGAATCCAGATGGCATGGTTGCTCTATTGGACTACCGTGAGGATGGTGTGACCCCATATATGATT
  TTCTTTAAGGATGGTTTAGAAATGGAAAAATGTGATGCAAAAGAAAGAAATCCCTGCGCTTTCTGTCTG
  TCTTTGTGGCGGCCCAGATTGAATTGGGGAATACATCTTTAG
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001286272
• Insert Size: 594 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001286272.1
• RefSeq Size: 4814 bp
• RefSeq ORF: 594 bp
• Locus ID: 7178
• Cytogenetics: 13q14.13
• MW: 22.6 kDa
• Gene Summary: This gene encodes a protein that is a regulator of cellular growth and proliferation. Its mRNA is highly structured and contains an oligopyrimidine tract (5'-TOP) in its 5' untranslated region that functions to repress its translation under quiescent conditions. The encoded protein is involved in a variety of cellular pathways, including apoptosis, protein synthesis and cell division. It binds to and stabilizes microtubules, and removal of this protein through phosphorylation is required for progression through mitotic and meiotic cell divisions. This gene is known to play a role in carcinogenesis, and is upregulated in some cancer cells. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2017]
  Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.