Casein Kinase 2 beta (CSNK2B) (NM_001282385) Human Untagged Clone

CAT#: SC334499

CSNK2B (untagged) - Human casein kinase 2, beta polypeptide (CSNK2B), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CSNK2B
• Synonyms: CK2B; CK2N; Ckb1; Ckb2; CSK2B; G5A; POBINDS
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334499 representing NM_001282385.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGAGCAGCTCAGAGGAGGTGTCCTGGATTTCCTGGTTCTGTGGGCTCCGTGGCAATGAATTCTTCTGT
  GAAGTGGATGAAGACTACATCCAGGACAAATTTAATCTTACTGGACTCAATGAGCAGGTCCCTCACTAT
  CGACAAGCTCTAGACATGATCTTGGACCTGGAGCCTGATGAAGAACTGGAAGACAACCCCAACCAGAGT
  GACCTGATTGAGCAGGCAGCCGAGATGCTTTATGGATTGATCCACGCCCGCTACATCCTTACCAACCGT
  GGCATCGCCCAGATGTTGGAAAAGTACCAGCAAGGAGACTTTGGTTACTGTCCTCGTGTGTACTGTGAG
  AACCAGCCAATGCTTCCCATTGACATCCCAGGTGAAGCCATGGTGAAGCTCTACTGCCCCAAGTGCATG
  GATGTGTACACACCCAAGTCATCAAGACACCATCACACGGATGGCGCCTACTTCGGCACTGGTTTCCCT
  CACATGCTCTTCATGGTGCATCCCGAGTACCGGCCCAAGAGACCTGCCAACCAGTTTGTGCCCAGGCTC
  TACGGTTTCAAGATCCATCCGATGGCCTACCAGCTGCAGCTCCAAGCCGCCAGCAACTTCAAGAGCCCA
  GTCAAGACGATTCGCTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001282385
• Insert Size: 639 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001282385.1
• RefSeq Size: 1140 bp
• RefSeq ORF: 639 bp
• Locus ID: 1460
• UniProt ID: P67870
• Cytogenetics: 6p21.33
• Protein Families: Druggable Genome
• Protein Pathways: Adherens junction, Tight junction, Wnt signaling pathway
• MW: 24.7 kDa
• Gene Summary: This gene encodes the beta subunit of casein kinase II, a ubiquitous protein kinase which regulates metabolic pathways, signal transduction, transcription, translation, and replication. The enzyme is composed of three subunits, alpha, alpha prime and beta, which form a tetrameric holoenzyme. The alpha and alpha prime subunits are catalytic, while the beta subunit serves regulatory functions. The enzyme localizes to the endoplasmic reticulum and the Golgi apparatus. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
  Transcript Variant: This variant (2) uses an alternate in-frame splice junction in the 3' coding sequence compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.