NPM2 (NM_001286680) Human Untagged Clone

CAT#: SC334513

NPM2 (untagged) - Human nucleophosmin/nucleoplasmin 2 (NPM2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NPM2
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC334513 representing NM_001286680.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGAATCTCAGTAGCGCCAGTAGCACGGAGGAAAAGGCAGTGACGACCGTGCTCTGGGGCTGCGAGCTC
  AGTCAGGAGAGGCGGACTTGGACCTTCAGACCCCAGCTGGAGGGGAAGCAGAGCTGCAGGCTGTTGCTT
  CATACGATTTGCTTGGGGGAGAAAGCCAAAGAGGAGATGCATCGCGTGGAGATCCTGCCCCCAGCAAAC
  CAGGAGGACAAGAAGATGCAGCCGGTCACCATTGCCTCACTCCAGGCCTCAGTCCTCCCCATGGTCTCC
  ATGGTAGGAGTGCAGCTTTCTCCCCCAGTTACTTTCCAGCTCCGGGCTGGCTCAGGACCCGTGTTCCTC
  AGTGGCCAGGAACGTTATGAAGCATCAGACCTAACCTGGGAGGAGGAGGAGGAAGAAGAAGGGGAGGAG
  GAGGAAGAGGAAGAGGAAGATGATGAGGATGAGGATGCAGATATATCTCTGGAGGAGCAAAGCCCTGTC
  AAACAAGTCAAAAGGCTGGTGCCCCAGAAGCAGGCGAGCGTGGCTAAGAAAAAAAAGCTGGAAAAAGAA
  GAAGAGGAAATAAGAGCCAGCGTTAGAGACAAGAGCCCTGTGAAAAAGGCCAAAGCCACAGCCAGAGCC
  AAGAAGCCAGGATTCAAGAAATGA
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001286680
• Insert Size: 645 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001286680.1
• RefSeq Size: 1532 bp
• RefSeq ORF: 645 bp
• Locus ID: 10361
• UniProt ID: Q86SE8
• Cytogenetics: 8p21.3
• MW: 24.2 kDa
• Gene Summary: Core histones chaperone involved in chromatin reprogramming, specially during fertilization and early embryonic development. Probably involved in sperm DNA decondensation during fertilization.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same isoform (1).