TMEM139 (NM_001282876) Human Untagged Clone

CAT#: SC334533

TMEM139 (untagged) - Human transmembrane protein 139 (TMEM139), transcript variant 8


  "NM_001282876" in other vectors (1)

Reconstitution Protocol

USD 341.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Rabbit Polyclonal Anti-TMEM139 Antibody
    • 100 ul

USD 375.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "TMEM139"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TMEM139
Vector pCMV6-Entry
Sequence Data
>SC334533 representing NM_001282876.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGTGCCAATGCACTTACTGGGGAGACTGGAGAAGCCGCTTCTCCTCCTGTGCTGCGCCTCCTTCCTA
CTGGGGCTGGCTTTGCTGGGCATAAAGACGGACATCACCCCCGTTGCTTATTTCTTTCTCACATTGGGT
GGCTTCTTCTTGTTTGCCTATCTCCTGGTCCGGTTTCTGGAATGGGGGCTTCGGTCCCAGCTCCAATCA
ATGCAGACTGAGAGCCCAGGGCCCTCAGGCAATGCACGGGACAATGAAGCCTTTGAAGTGCCAGTCTAT
GAAGAGGCCGTGGTGGGACTAGAATCCCAGTGCCGCCCCCAAGAGTTGGACCAACCACCCCCCTACAGC
ACTGTTGTGATACCCCCAGCACCTGAGGAGGAACAACCTAGCCATCCAGAGGGGTCCAGGAGAGCCAAA
CTGGAACAGAGGCGAATGGCCTCAGAGGGGTCCATGGCCCAGGAAGGAAGCCCTGGAAGAGCTCCAATC
AACCTTCGGCTTCGGGGACCACGGGCTGTGTCCACTGCTCCTGATCTGCAGAGCTTGGCGGCAGTCCCC
ACATTAGAGCCTCTGACTCCACCCCCTGCCTATGATGTCTGCTTTGGTCACCCTGATGATGATAGTGTT
TTTTATGAGGACAACTGGGCACCCCCTTAA

Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001282876
Insert Size 651 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001282876.1
RefSeq Size 2400 bp
RefSeq ORF 651 bp
Locus ID 135932
UniProt ID Q8IV31
Cytogenetics 7q34
Protein Families Transmembrane
MW 23.7 kDa
Gene Summary May be involved in cellular trafficking of proteins such as SLC4A1.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (8) differs in the 5' UTR compared to variant 1. Variants 1, 2, 3, 4, 8, and 9 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.