CYB561D2 (NM_001291284) Human Untagged Clone

CAT#: SC334580

CYB561D2 (untagged) - Human cytochrome b561 family, member D2 (CYB561D2), transcript variant 2


  "NM_001291284" in other vectors (1)

Reconstitution Protocol

USD 341.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Rabbit polyclonal anti-C56D2 antibody
    • 100 ul

USD 345.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "CYB561D2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CYB561D2
Synonyms 101F6; TSP10; XXcos-LUCA11.4
Vector pCMV6-Entry
Sequence Data
>SC334580 representing NM_001291284.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCCCTTTCTGCGGAGACCGAGTCACACATCTACCGAGCTCTGCGTACTGCTTCTGGCGCTGCCGCC
CACCTTGTGGCCCTGGGCTTTACCATCTTTGTGGCTGTGCTTGCCAGGCCTGGCTCCAGCCTGTTCTCC
TGGCACCCGGTGCTTATGTCTTTGGCTTTCTCCTTCCTGATGACCGAGGCACTACTGGTGTTTTCTCCT
GAGAGTTCGCTGCTGCACTCCCTCTCACGGAAAGGCCGAGCACGCTGCCACTGGGTGCTGCAGCTGCTG
GCCCTGCTGTGTGCACTGCTGGGCCTCGGCCTTGTCATCCTCCACAAAGAGCAGCTTGGCAAAGCCCAC
CTGGTTACGCGGCATGGGCAGGCAGGGCTGCTGGCTGTGCTGTGGGCAGGGCTGCAGTGCTCAGGTGGG
GTGGGGCTGCTCTACCCCAAGCTGCTGCCCCGATGGCCCCTGGCGAAGCTCAAGCTATACCATGCTACT
TCTGGGCTGGTGGGCTACCTGCTGGGTAGTGCCAGCCTCTTGCTGGGCATGTGCTCACTCTGGTTCACT
GCCTCTGTCACTGGTGCAGCCTGGTACCTGGCTGTATTATGCCCTGTCCTCACCAGCTTGGTCATTATG
AACCAGGTGAGCAATGCCTACCTATACCGCAAGAGGATCCAACCATGA

Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001291284
Insert Size 669 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001291284.1
RefSeq Size 1348 bp
RefSeq ORF 669 bp
Locus ID 11068
UniProt ID O14569
Cytogenetics 3p21.31
Protein Families Druggable Genome, Transmembrane
MW 24 kDa
Gene Summary Two-heme-containing cytochrome that catalyzes ascorbate-dependent trans-membrane ferric-chelate reduction.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses an alternate splice site in the 5' UTR, compared to variant 1. Variants 1 and 2 encode the protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.