VTA1 (NM_001286372) Human Untagged Clone

CAT#: SC334585

VTA1 (untagged) - Human vesicle (multivesicular body) trafficking 1 (VTA1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: VTA1
• Synonyms: C6orf55; DRG-1; DRG1; HSPC228; LIP5; My012; SBP1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334585 representing NM_001286372.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGACAAGCGAGACCCTGTGGTGGCTTATTACTCTAAAGAAGCAGTTGGGTGATAATGAAGCTATTACT
  CAAGAAATAGTGGGCTGTGCCCATTTGGAGAATTATGCTTTGAAAATGTTTTTGTATGCAGACAATGAA
  GATCGTGCTGGACGATTTCACAAAAACATGATCAAGTCCTTCTATACTGCAAGTCTTTTGATAGATGTC
  ATAACAGTATTTGGAGAACTCACTGATGAAAATGTGAAACACAGGAAGTATGCCAGATGGAAGGCAACA
  TACATCCATAATTGTTTAAAGAATGGGGAGACTCCTCAAGCAGGCCCTGTTGGAATTGAAGAAGATAAT
  GATATTGAAGAAAATGAAGATGCTGGAGCAGCCTCTCTGCCCACTCAGCCAACTCAGCCATCATCATCT
  TCAACTTATGACCCAAGCAACATGCCATCAGGCAACTATACTGGAATACAGATTCCTCCGGGTGCACAC
  GCTCCAGCTAATACACCAGCAGAAGTGCCTCACAGCACAGGGGATGTTCGTCTAACCCCAGAAGACTTT
  GCTAGAGCTCAGAAGTACTGCAAATATGCTGGCAGTGCTTTGCAGTATGAAGATGTAAGCACTGCTGTC
  CAGAATCTACAAAAGGCTCTCAAGTTACTGACGACAGGCAGAGAATGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001286372
• Insert Size: 669 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001286372.1
• RefSeq Size: 3195 bp
• RefSeq ORF: 669 bp
• Locus ID: 51534
• UniProt ID: Q9NP79
• Cytogenetics: 6q24.1-q24.2
• Protein Pathways: Endocytosis
• MW: 24.6 kDa
• Gene Summary: C6ORF55 encodes a protein involved in trafficking of the multivesicular body, an endosomal compartment involved in sorting membrane proteins for degradation in lysosomes (Ward et al., 2005 [PubMed 15644320]).[supplied by OMIM, Mar 2008]
  Transcript Variant: This variant (3) lacks an alternate exon in the 5' coding region that results in the use of an alternate translational start codon, and it lacks an alternate in-frame exon in the 3' coding region, compared to variant 1. The encoded isoform (c) has a distinct N-terminus and is shorter than isoform a.