TMEM98 (NM_001301746) Human Untagged Clone

CAT#: SC334611

TMEM98 (untagged) - Human transmembrane protein 98 (TMEM98), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TMEM98
• Synonyms: TADA1
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC334611 representing NM_001301746.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGGAGACTGTGGTGATTGTTGCCATAGGTGTGCTGGCCACCATCTTTCTGGCTTCGTTTGCAGCCTTG
  GTGCTGGTTTGCAGGCAGCGCTACTGCCGGCCGCGAGACCTGCTGCAGCGCTATGATTCTAAGCCCATT
  GTGGACCTCATTGGTGCCATGGAGACCCAGTCTGAGCCCTCTGAGTTAGAACTGGACGATGTCGTTATC
  ACCAACCCCCACATTGAGGCCATTCTGGAGAATGAAGACTGGATCGAAGATGCCTCGGGTCTCATGTCC
  CACTGCATTGCCATCTTGAAGATTTGTCACACTCTGACAGAGAAGCTTGTTGCCATGACAATGGGCTCT
  GGGGCCAAGATGAAGACTTCAGCCAGTGTCAGCGACATCATTGTGGTGGCCAAGCGGATCAGCCCCAGG
  GTGGATGATGTTGTGAAGTCGATGTACCCTCCGTTGGACCCCAAACTCCTGGACGCACGGACGACTGCC
  CTGCTCCTGTCTGTCAGTCACCTGGTGCTGGTGACAAGGAATGCCTGCCATCTGACGGGAGGCCTGGAC
  TGGATTGACCAGTCTCTGTCGGCTGCTGAGGAGCATTTGGAAGTCCTTCGAGAAGCAGCCCTAGCTTCT
  GAGCCAGATAAAGGCCTCCCAGGCCCTGAAGGCTTCCTGCAGGAGCAGTCTGCAATTTAG
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001301746
• Insert Size: 681 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001301746.1
• RefSeq Size: 1880 bp
• RefSeq ORF: 681 bp
• Locus ID: 26022
• UniProt ID: Q9Y2Y6
• Cytogenetics: 17q11.2
• Protein Families: Transmembrane
• MW: 24.6 kDa
• Gene Summary: This gene encodes a transmembrane protein. A missense mutation in this gene result in Nanophthalmos 4 (NNO4). Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Sep 2014]
  Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.