RAD52 (NM_001297420) Human Untagged Clone

CAT#: SC334615

RAD52 (untagged) - Human RAD52 homolog (S. cerevisiae) (RAD52), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RAD52
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334615 representing NM_001297420.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGTCTGGGACTGAGGAAGCAATTCTTGGAGGACGTGACAGCCATCCTGCTGCTGGCGGCGGCTCAGTG
  TTATGCTTTGGACAGTGCCAGTACACAGCAGAAGAGTACCAGGCCATCCAGAAGGCCCTGAGGCAGAGG
  CTGGGCCCAGAATACATAAGTAGCCGCATGGCTGGCGGAGGCCAGAAGGTGTGCTACATTGAGGGTCAT
  CGGGTAATTAATCTGGCCAATGAGATGTTTGGTTACAATGGCTGGGCACACTCCATCACGCAGCAGAAT
  GTGGATTTTGTTGACCTCAACAATGGCAAGTTCTACGTGGGAGTCTGTGCATTTGTGAGGGTCCAGCTG
  AAGGATGGTTCATATCATGAAGATGTTGGTTATGGTGTTAGTGAGGGCCTCAAGTCCAAGGCTTTATCT
  TTGGAGAAGGCAAGGAAGGAGGCGGTGACAGACGGGCTGAAGCGAGCCCTCAGGCTTCCCTTGCTGGGA
  GTAAGTGGTAGAATCCTGTACTCTCTCTTCTCCGTGCACTCAGTCATGTGTGCCGGAGGCCTTCCCACT
  CCTACTGCGAGTGCACAGACAGCACCCTCCTCTCCGTGCTCCTCAGCAGTCCTCCGCTACGCACAGGAG
  TTTTGGGAATGCACTTGGAAACTGTATTCTGGACAAAGACTACCTGAGATCACTAAATAA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001297420
• Insert Size: 681 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001297420.1
• RefSeq Size: 712 bp
• RefSeq ORF: 681 bp
• Locus ID: 5893
• UniProt ID: P43351
• Cytogenetics: 12p13.33
• Protein Families: Druggable Genome
• Protein Pathways: Homologous recombination
• MW: 24.5 kDa
• Gene Summary: The protein encoded by this gene shares similarity with Saccharomyces cerevisiae Rad52, a protein important for DNA double-strand break repair and homologous recombination. This gene product was shown to bind single-stranded DNA ends, and mediate the DNA-DNA interaction necessary for the annealing of complementary DNA strands. It was also found to interact with DNA recombination protein RAD51, which suggested its role in RAD51 related DNA recombination and repair. A pseudogene of this gene is present on chromosome 2. Alternative splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Jul 2014]
  Transcript Variant: This variant (3) lacks several coding exons, and contains an alternate exon in the coding region, resulting in a novel 3' coding region and 3' UTR compared to variant 1. The encoded isoform (b, also known as beta) has a distinct C-terminus and is shorter than isoform a.