ICT1 (MRPL58) (NM_001303265) Human Untagged Clone

CAT#: SC334631

ICT1 (untagged) - Human immature colon carcinoma transcript 1 (ICT1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MRPL58
• Synonyms: DS-1; DS1; ICT1; MRP-L58
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334631 representing NM_001303265.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGCGGCCACCAGGTGCCTGCGCTGGGGCCTGAGCCGAGCCGGAGTCTGGCTGCTCCCACCGCCCGCA
  CGGTGCCCACGCCGGGCGCTGCACAAGCAGAAAGACGGCACTGAGTTCAAGAGCATCTACAGCCTGGAC
  AAGCTCTACCCCGAATCTCAGGGCTCGGACACCGCCTGGAGGGTCCCGAATGGTGCAAAGCAAGCCGAC
  AGTGACATCCCTCTAGATCGCTTGACAATATCTTATTGTCGGAGTAGTGGTCCTGGGGGGCAGAATGTG
  AACAAAGTGAATTCCAAGGCAGAAGTCAGGTTCCATTTGGCAACTGCCGAGTGGATCGCGGAGCCCGTG
  CGGCAGAAGATAGCCATCACGCATAAAAACAAGATCAACAGGTTAGGAGAGTTGATCCTCACCTCTGAG
  AGCAGCCGCTATCAGTTCCGGAATCTGGCAGATTGCCTGCAGAAAATTCGAGACATGATCACTGAGGCC
  AGCCAGACACCGAAGGAGCCAACAAAAGAAGATGTTAAACTTCATAGAATCAGAAAACATGAATCGGGA
  AAGGCTGAGACAAAAGAGAATTCATTCTGCTGTAAAGACAAGCAGGAGGGTCGACATGGACTGAAATCA
  CCCTCTGCAGCTGGGAGGGCTCTTCTGGGCGTCCGGGCAGCTGCAGCTGAGAGGACTTTCACACCATAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001303265
• Insert Size: 690 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001303265.1
• RefSeq Size: 909 bp
• RefSeq ORF: 690 bp
• Locus ID: 3396
• UniProt ID: Q14197
• Cytogenetics: 17q25.1
• MW: 25.6 kDa
• Gene Summary: The protein encoded by this gene is a peptidyl-tRNA hydrolase and a vital component of the large mitochondrial ribosome. The encoded protein serves as a ribosome release factor for this ribosome, which translates mitochondrial genes. This protein may be responsible for degrading prematurely-terminated polypeptides and for reusing stalled ribosomes. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2014]
  Transcript Variant: This variant (2) uses an alternate splice junction in the 3' coding region compared to variant 1, that causes a frameshift. The resulting isoform (2) has a longer and distinct C-terminus compared to isoform 1.