DCUN1D4 (NM_001287757) Human Untagged Clone

CAT#: SC334657

DCUN1D4 (untagged) - Human DCN1, defective in cullin neddylation 1, domain containing 4 (DCUN1D4), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DCUN1D4
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334657 representing NM_001287757.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGCCACCAAGGAAAAAGAGAAGACCTGCCTCTGGAGATGATTTATCTGCCAAGAAAAGTAGACATGAT
  AGCATGTATAGAAAATATGATTCGACTAGAATAAAGACTGAAGAAGAAGCCTTTTCAAGTAAAAGGTGC
  TTGGAATGGTTCTATGAATATGCAGGAACTGATGATGTTGTAGGCCCTGAAGGCATGGAGAAATTTTGT
  GAAGACATTGGTGTTGAACCAGAAAACGTAGTTATGCTTGTCCTAGCTTGGAAATTGGATGCACAAAAC
  ATGGGTTATTTTACTCTACAGGAGTGGTTAAAAGGAATGACTTCTCTCCAATGTGATACAACAGAAAAA
  CTCAGAAATACTTTGGATTACTTAAGATCATTCTTAAATGATTCTACAAACTTTAAACTTATTTACAGA
  TATGCGTTTGACTTTGCACGGGAAAAGGACCAGCGCAGCCTAGACATAAACACTGCCAAGTGCATGTTG
  GGACTGTTATTAGGAAAAATCTGGCCCCTTTTTCCAGTTTTTCACCAATTCTTAGAGCAATCAAAATAC
  AAAGTTATTAATAAAGACCAGTGGTGCAATGTCCTAGAGTTTAGCAGAACAATTAATCTTGACCTCAGC
  AACTATGATGAAGATGGAGCATGGCCAGTTTTGTTGGACGAGTTTGTGGAGTGGTATAAAGACAAACAG
  ATGTCCTAG
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001287757
• Insert Size: 699 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001287757.1
• RefSeq Size: 4551 bp
• RefSeq ORF: 699 bp
• Locus ID: 23142
• UniProt ID: Q92564
• Cytogenetics: 4q12
• MW: 27.4 kDa
• Gene Summary: Contributes to the neddylation of all cullins by transfering NEDD8 from N-terminally acetylated NEDD8-conjugating E2s enzyme to different cullin C-terminal domain-RBX complexes which are necessary for the activation of cullin-RING E3 ubiquitin ligases (CRLs).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (4) has two alternate exons in place of the first exon compared to variant 3. The resulting isoform (4) is shorter at the N-terminus compared to isoform 3.