JKAMP (NM_001284203) Human Untagged Clone

CAT#: SC334805

JKAMP (untagged) - Human JNK1/MAPK8-associated membrane protein (JKAMP), transcript variant 5


  "NM_001284203" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "JKAMP"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol JKAMP
Synonyms C14orf100; C24orf100; CDA06; HSPC213; HSPC327; JAMP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334805 representing NM_001284203.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCAATGCTTCCTCTGGTTTTACATTGGTTCTTCATTGAATGGTACTCGGGGAAAAAGAGTTCCAGC
GCACTTTTCCAACACATCACTGCATTATTTGAATGCAGCATGGCAGCTATTATCACCTTACTTGTGAGT
GATCCAGTTGGTGTTCTTTATATTCGTTCATGTCGAGTATTGATGCTTTCTGACTGGTACACGATGCTT
TACAACCCAAGTCCAGATTACGTTACCACAGTACACTGTACTCATGAAGCCGTCTACCCACTATATACC
ATTGTATTTATCTATTACGCATTCTGCTTGGTATTAATGATGCTGCTCCGACCTCTTCTGGTGAAGAAG
ATTGCATGTGGGTTAGGGAAATCTGATCGATTTAAAAGTATTTATGCTGCACTTTACTTCTTCCCAATT
TTAACCGTGCTTCAGGCAGTTGGTGGAGGCCTTTTATATTACGCCTTCCCATACATTATATTAGTGTTA
TCTTTGGTTACTCTGGCTGTGTACATGTCTGCTTCTGAAATAGAGAACTGCTATGATCTTCTGGTCAGA
AAGAAAAGACTTATTGTTCTCTTCAGCCACTGGTTACTTCATGCCTATGGAATAATCTCCATTTCCAGA
GTGGATAAACTTGAGCAAGATTTGCCCCTTTTGGCTTTGGTACCTACACCAGCCCTTTTTTACTTGTTC
ACTGCAAAATTTACCGAACCTTCAAGGATACTCTCAGAAGGAGCCAATGGACACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001284203
Insert Size 747 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001284203.1
RefSeq Size 2461 bp
RefSeq ORF 747 bp
Locus ID 51528
UniProt ID Q9P055
Cytogenetics 14q23.1
Protein Families Transmembrane
MW 28.2 kDa
Gene Summary May be a regulator of the duration of MAPK8 activity in response to various stress stimuli. Facilitates degradation of misfolded endoplasmic reticulum (ER) luminal proteins through the recruitment of components of the proteasome and endoplasmic reticulum-associated degradation (ERAD) system (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (5) uses an alternate splice site in the 5' region and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (5) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.