PGAP2 (NM_001283039) Human Untagged Clone

CAT#: SC334815

PGAP2 (untagged) - Human post-GPI attachment to proteins 2 (PGAP2), transcript variant 18

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PGAP2
• Synonyms: CWH43-N; FRAG1; HPMRS3; MRT17; MRT21
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334815 representing NM_001283039.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGCTAGATTGGGAAGCACCGGCGGGGTGTCGGGAAGGGTGGTGACGCAACATAGAGACTCCGCCCCC
  TTCCTTGGAGCGCCGCGACTCGGGCTGAGGGAGCTCGGGCCAATCAGAGGGACGGCCCCAGAATGGCAT
  GGTAGATGGAACGCAGCTGAGAGGCAGGTTCCAGTCTGCGGGGGAGATGGAGAAGGTGCCACCATGCTG
  CTGCACAAATCCCAGGATAGCTGGGGAATGAGAATCCAGCACTTTGGGCCTAGGACCTGGAAGGAGAGG
  TCTTTTGGGAGAGGTGCCCAATTACCTGCCCTCGGTGAGCTCAGCCATCGGCGGGGAGGTGCCCCAGCG
  CTACGTGTGGCGTTTCTGCATCGGCCTGCACTCGGCGCCTCGCTTCTTGGTGGCCTTCGCCTACTGGAA
  CCACTACCTCAGCTGCACCTCCCCGTGTTCCTGCTATCGCCCGCTCTGCCGCCTCAACTTCGGCCTCAA
  TGTCGTGGAGAACCTCGCGTTGCTAGTGCTCACTTATGTCTCCTCCTCCGAGGACTTCACCATCCACGA
  AAATGCTTTCATTGTGTTCATTGCCTCATCCCTCGGGCACATGCTCCTCACCTGCATTCTCTGGCGGTT
  GACCAAGAAGCACACAGTAAGTCAGGAGGATCGCAAGTCCTACAGCTGGAAACAGCGGCTCTTCATCAT
  CAACTTCATCTCCTTCTTCTCGGCGCTGGCTGTCTACTTTCGGCACAACATGTATTGTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001283039
• Insert Size: 750 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001283039.1
• RefSeq Size: 1841 bp
• RefSeq ORF: 750 bp
• Locus ID: 27315
• UniProt ID: Q9UHJ9
• Cytogenetics: 11p15.4
• Protein Families: Druggable Genome, Transmembrane
• MW: 26.9 kDa
• Gene Summary: The protein encoded by this gene plays a role in the maturation of glycosylphosphatidylinositol (GPI) anchors on GPI-anchored proteins. Mutations in this gene are associated with an autosomal recessive syndrome characterized by hyperphosphatasia and intellectual disability. [provided by RefSeq, Jul 2017]
  Transcript Variant: This variant (18) uses an alternate exon structure in the 5' region compared to variant 1. The encoded isoform (10) is distinct and shorter, compared to isoform 1, but it shares regions in common with isoforms 5 and 7.