CYB5R2 (NM_001302826) Human Untagged Clone

CAT#: SC334993

CYB5R2 (untagged) - Human cytochrome b5 reductase 2 (CYB5R2), transcript variant 1


  "NM_001302826" in other vectors (1)

Reconstitution Protocol

USD 310.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "CYB5R2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CYB5R2
Synonyms B5R.2
Vector PCMV6-Neo
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001302826, the custom clone sequence may differ by one or more nucleotides


ATGAACTCCAGGAGGAGAGAGCCAATCACCTTACAGGACCCTGAAGCCAAGTACCCGCTGCCCTTGATTG
AGAAAGAGAAAATCAGCCACAACACCCGGAGGTTCCGCTTTGGACTGCCTTCGCCGGACCATGTCTTAGG
GCTTCCTGTAGGTAACTATGTCCAGCTCTTGGCAAAAATCGATAATGAATTGGTGGTCAGGGCTTACACC
CCTGTCTCCAGTGATGATGACAGAGGCTTTGTGGACCTAATTATAAAGATCTACTTCAAAAATGTACACC
CCCAATATCCTGAAGGTGGGAAGATGACTCAGTATTTGGAGAACATGAAAATCGGGGAGACCATCTTTTT
TCGAGGGCCAAGGGGACGCTTGTTTTACCATGGGCCAGGGAATCTTGGAATCAGACCAGACCAGACGAGT
GAGCCTAAAAAAACACTGGCCGATCACCTGGGAATGATTGCTGGGGGCACAGGCATCACACCCATGTTGC
AGCTCATTCGCCACATCACCAAGGACCCCAGTGACAGGACCAGGATGTCCCTCATCTTTGCCAACCAGAC
AGAGGAGGATATCTTGGTCAGAAAAGAGCTTGAAGAAATTGCCAGGACTCACCCAGACCAGTTCAACCTG
TGGTACACCCTGGACAGGCCTCCCATTGGCTGGAAGTACAGCTCAGGCTTCGTTACTGCCGACATGATCA
AGGAGCACCTTCCTCCTCCAGCGAAGTCCACGCTCATCCTGGTGTGTGGCCCGCCACCACTAATCCAGAC
GGCGGCTCACCCTAACCTGGAGAAGCTGGGTTATACCCAGGACATGATTTTCACCTACTAA


Restriction Sites SgfI-MluI     
ACCN NM_001302826
ORF Size 831 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001302826.1, NP_001289755.1
RefSeq Size 1713
RefSeq ORF 831
Locus ID 51700
Protein Families Druggable Genome
Gene Summary The protein encoded by this gene belongs to the flavoprotein pyridine nucleotide cytochrome reductase family of proteins. Cytochrome b-type NAD(P)H oxidoreductases are implicated in many processes including cholesterol biosynthesis, fatty acid desaturation and elongation, and respiratory burst in neutrophils and macrophages. Cytochrome b5 reductases have soluble and membrane-bound forms that are the product of alternative splicing. In animal cells, the membrane-bound form binds to the endoplasmic reticulum, where it is a member of a fatty acid desaturation complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1). Both variants 1 and 2 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.