METTL9 (NM_001288660) Human Untagged Clone

CAT#: SC335004

METTL9 (untagged) - Human methyltransferase like 9 (METTL9), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: METTL9
• Synonyms: CGI-81; DREV; DREV1; PAP1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC335004 representing NM_001288660.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGATCGAAAGACCACGAGCTGGGATACCAAGTTCTATGAAAAGTGGTATGTGTGCAACAGAGAGAAA
  TTATGCGAATCACTCCAGGCTGTCTTTGTTCAGAGTTACCTTGATCAAGGAACACAGATCTTCTTAAAC
  AACAGCATTGAGAAATCGGGCTGGCTATTTATCCAATTATATCATTCTTTTGTGTCATCTGTTTTTAGC
  CTGTTTATGTCTAGAACATCTATCAATGGGTTGCTAGGAAGAGGCTCAATGTTTGTGTTTTCACCAGAT
  CAGTTTCAGAGACTGCTTAAAATTAATCCAGACTGGAAAACCCACAGACTTCTTGATTTAGGTGCTGGA
  GATGGAGAAGTCACAAAAATCATGAGCCCTCATTTTGAAGAAATCTATGCCACTGAGCTTTCTGAAACT
  ATGATATGGCAGCTTCAGAAAAAGAAATACAGAGTCCTTGGTATAAATGAATGGCAGAATACGGGGTTC
  CAGTATGATGTCATCAGCTGCCTGAACTTGCTGGACCGCTGTGATCAGCCCCTGACTTTGTTAAAAGAT
  ATCAGAAGTGTCTTGGAGCCAACTAGAGGCAGGGTCATCCTTGCCCTTGTCCTCCCCTTTCATCCCTAT
  GTGGAAAACGGTGGCAAGTGGGAGAAACCATCAGAAATTTTGGAAATCAAAGGACAGAACTGGGAAGAA
  CAAGTGAATAGTCTGCCTGAAGTTTTCAGAAAAGCTGGTTTTGTTATCGAAGCTTTCACCAGACTACCA
  TACCTGTGTGAAGGCGACATGTATAATGACTACTACGTTCTGGATGACGCTGTCTTTGTTCTCAAACCA
  GTATAA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001288660
• Insert Size: 834 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001288660.1
• RefSeq Size: 2921 bp
• RefSeq ORF: 834 bp
• Locus ID: 51108
• UniProt ID: Q9H1A3
• Cytogenetics: 16p12.2
• MW: 32.4 kDa
• Gene Summary: Protein-histidine N-methyltransferase that specifically catalyzes 1-methylhistidine (pros-methylhistidine) methylation of target proteins (PubMed:33563959). Mediates methylation of proteins with a His-x-His (HxH) motif (where 'x' is preferably a small amino acid) (PubMed:33563959). Catalyzes methylation of target proteins such as S100A9, NDUFB3, SLC39A5, SLC39A7, ARMC6 and DNAJB12; 1-methylhistidine modification may affect the binding of zinc and other metals to its target proteins (PubMed:33563959). Constitutes the main methyltransferase for the 1-methylhistidine modification in cell (PubMed:33563959).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (4) differs in the 5' UTR, uses an alternate in-frame splice site in the 3' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (4) is shorter and has a distinct N-terminus, compared to isoform 1.