KRT23 (NM_001282433) Human Untagged Clone

CAT#: SC335078

KRT23 (untagged) - Human keratin 23 (histone deacetylase inducible) (KRT23), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: KRT23
• Synonyms: CK23; HAIK1; K23
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC335078 representing NM_001282433.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGACCAATGCTCAGATTATTCTTCTCATTGACAATGCCAGGATGGCAGTGGATGACTTCAACCTCAAG
  TATGAAAATGAACACTCCTTTAAGAAAGACTTGGAAATTGAAGTCGAGGGCCTCCGAAGGACCTTAGAC
  AACCTGACCATTGTCACAACAGACCTAGAACAGGAGGTGGAAGGAATGAGGAAAGAGCTCATTCTCATG
  AAGAAGCACCATGAGCAGGAAATGGAGAAGCATCATGTGCCAAGTGACTTCAATGTCAATGTGAAGGTG
  GATACAGGTCCCAGGGAAGATCTGATTAAGGTCCTGGAGGATATGAGACAAGAATATGAGCTTATAATA
  AAGAAGAAGCATCGAGACTTGGACACTTGGTATAAAGAACAGTCTGCAGCCATGTCCCAGGAGGCAGCC
  AGTCCAGCCACTGTGCAGAGCAGACAAGGTGACATCCACGAACTGAAGCGCACATTCCAGGCCCTGGAG
  ATTGACCTGCAGACACAGTACAGCACGAAATCTGCTTTGGAAAACATGTTATCCGAGACCCAGTCTCGG
  TACTCCTGCAAGCTCCAGGACATGCAAGAGATCATCTCCCACTATGAGGAGGAACTGACGCAGCTACGC
  CATGAACTGGAGCGGCAGAACAATGAATACCAAGTGCTGCTGGGCATCAAAACCCACCTGGAGAAGGAA
  ATCACCACGTACCGACGGCTCCTGGAGGGAGAGAGTGAAGGGACACGGGAAGAATCAAAGTCGAGCATG
  AAAGTGTCTGCAACTCCAAAGATCAAGGCCATAACCCAGGAGACCATCAACGGAAGATTAGTTCTTTGT
  CAAGTGAATGAAATCCAAAAGCACGCATGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001282433
• Insert Size: 858 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001282433.1
• RefSeq Size: 1700 bp
• RefSeq ORF: 858 bp
• Locus ID: 25984
• UniProt ID: Q9C075
• Cytogenetics: 17q21.2
• MW: 33.3 kDa
• Gene Summary: The protein encoded by this gene is a member of the keratin family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. The type I cytokeratins consist of acidic proteins which are arranged in pairs of heterotypic keratin chains. The type I cytokeratin genes are clustered in a region of chromosome 17q12-q21. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
  Transcript Variant: This variant (2) differs in the 5' UTR and has multiple coding region differences, compared to variant 1. These differences cause translation initiation at a downstream AUG and result in an isoform (2) with a shorter N-terminus, compared to isoform 1.