zinc finger protein 138 (ZNF138) (NM_001271638) Human Untagged Clone

CAT#: SC335102

ZNF138 (untagged) - Human zinc finger protein 138 (ZNF138), transcript variant 6


  "NM_001271638" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Rabbit Polyclonal Anti-ZNF138 Antibody
    • 100 ul

USD 375.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "ZNF138"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ZNF138
Synonyms pHZ-32
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335102 representing NM_001271638.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGATGTGGCCATAGAGTTCTCTTTGGAGGAGTGGCAGTGCCTGGACACTGCACAGCGGAATGTATAT
AGGCATGTGATGTTAGAGAACTACAGAAACCTGGTTTTCTTGGCTCTGTGTTCTCGTTTTGCCCAAGAC
CTTTGGCTAGAGCAGAACATAAAAGATTCTTTCCAAAAAGTGACACTGAGCAGATATGGAAAATATGGA
CATAAGAATTTACAGTTAAGAAAAGGCTGTAAAAGTGTGGATGAGTGTAAGGGACACCAAGGAGGTTAT
AATGGACTTAACCAATGTTTGAAAATTACCACAAGCAAAATATTTCAATGTAATAAATATGTAAAAGTC
ATGCATAAATTTTCAAATTCAAATAGACACAAGATAAGACATACTGAAAATAAACATTTCAGATGTAAA
GAATGTGACAAATCACTTTGCATGCTTTCACGCCTAACTCAACATAAAAAAATTCATACTAGAGAGAAT
TTCTACAAATGTGAAGAGTGTGGAAAAACCTTTAACTGGTCCACAAACCTTTCTAAACCTAAGAAAATT
CATACTGGAGAAAAACCCTACAAATGTGAAGTATGTGGAAAAGCCTTTCACCAATCCTCAATCCTTACT
AAACATAAGATAATTCGTACTGGAGAAAAACCCTATAAATGTGCACACTGTGGCAAAGCCTTTAAACAG
TCCTCACACCTTACTAGACATAAGATAATTCATACTGAAGAGAAACCCTACAAATGTGAACAATGTGGC
AAGGTCTTTAAGCAGTCCCCAACCCTTACTAAACATCAGATAATTTATACTGGAGAGGAACCATACAAA
TGTGAGGAATGTGGCAAAGCTTTTAACCTATCTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001271638
Insert Size 864 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001271638.1
RefSeq Size 2631 bp
RefSeq ORF 864 bp
Locus ID 7697
Cytogenetics 7q11.21
Protein Families Transcription Factors
MW 33.7 kDa
Gene Summary May be involved in transcriptional regulation as a repressor.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (6) includes an alternate exon, and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (5) has a shorter N-terminus, compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.