Mannose Phosphate Isomerase (MPI) (NM_001289155) Human Untagged Clone

CAT#: SC335105

MPI (untagged) - Human mannose phosphate isomerase (MPI), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MPI
• Synonyms: CDG1B; PMI; PMI1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC335105 representing NM_001289155.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGCCGCTCCGCGAGTATTCCCACTTTCCTGTGCGGTGCAGCAGTATGCCTGGGGGAAGATGGGTTCC
  AACAGCGAAGTGGCGCGGCTGTTGGCCAGCAGTGATCCACTGGCCCAGATCGCAGAGGACAAGCCTTAT
  GCAGAGTTGTGGATGGGGACTCACCCCCGAGGGGATGCCAAGATCCTTGACAACCGCATCTCACAGAAG
  ACCCTAAGCCAGTGGATTGCTGAGAACCAGGACAGCTTGGGCTCAAAGGTCAAGGACACCTTTAATGGC
  AACCTGCCCTTCCTCTTCAAAGTGCTCTCAGTTGAAACACCCCTGTCCATCCAGGCACACCCTAACAAG
  GAGCTGGCAGAGAAGCTGCACCTCCAGGCTCCGCAGCACTACCCCGATGCCAACCACAAGCCAGAGATG
  GCCATTGCCCTCACCCCCTTCCAGGGCTTGTGTGGCTTCCGGCCAGTTGAGGAGATTGTAACCTTTCTA
  AAGAAGGTGCCTGAGTTTCAGTTCCTGATTGGAGATGAGGCAGCAACACACCTGAAGCAGACCATGAGC
  CATGACTCCCAGGCTGTGGCCTCCTCTCTGCAGAGCTGTTTCTCCCACCTGATGAAGAGTGAGAAGAAG
  GTGGTGGTGGAACAGCTCAACCTGTTGGTGAAGCGGATCTCCCAGCAAGCGGCTGCCGGAAACAACATG
  GAGGACATCTTTGGGGAGCTTTTGCTACAGCTGCACCAGCAGTACCCAGGTGATATCGGCTGCTTTGCC
  ATCTACTTCCTGAACCTGCTTACCCTGAAGCCTGGGGAGGCCATGTTTCTGGAGGCCAACGTACCCCAT
  GCCTACCTGAAAGGAGGTCCCTGGCTCTGTCACTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001289155
• Insert Size: 864 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001289155.1
• RefSeq Size: 2868 bp
• RefSeq ORF: 864 bp
• Locus ID: 4351
• Cytogenetics: 15q24.1
• Protein Families: ES Cell Differentiation/IPS
• Protein Pathways: Amino sugar and nucleotide sugar metabolism, Fructose and mannose metabolism, Metabolic pathways
• MW: 31.9 kDa
• Gene Summary: Phosphomannose isomerase catalyzes the interconversion of fructose-6-phosphate and mannose-6-phosphate and plays a critical role in maintaining the supply of D-mannose derivatives, which are required for most glycosylation reactions. Mutations in the MPI gene were found in patients with carbohydrate-deficient glycoprotein syndrome, type Ib. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
  Transcript Variant: This variant (2) lacks an exon in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2) has a shorter and distinct C-terminus, compare to isoform 1.