TTC4 (NM_001291333) Human Untagged Clone

CAT#: SC335112

TTC4 (untagged) - Human tetratricopeptide repeat domain 4 (TTC4), transcript variant 2


  "NM_001291333" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Rabbit Polyclonal Anti-TTC4 Antibody
    • 100 ul

USD 375.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "TTC4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TTC4
Synonyms CNS1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335112 representing NM_001291333.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAACAACCTGGGCAGGATCCCACCTCAGACGACGTCATGGACTCGTTCCTGGAAAAGTTCCAGAGC
CAGCCTTACCGTGGCGGCTTTCATGAGGACCAGTGGGAGAAGGAATTTGAAAAGGTCCCCCTATTTATG
TCGAGAGCGCCATCAGAAATTGATCCCAGGGAGAATCCTGACTTGGCTTGTCTCCAGTCAATTATTTTT
GATGAGGAGCGTTCTCCAGAAGAACAGGCCAAGACCTATAAAGATGAGGGCAATGATTACTTTAAAGAA
AAAGACTACAAGAAAGCTGTAATTTCATACACTGAAGGCTTAAAGAAGAAATGTGCAGATCCTGATTTG
AATGCTGTCCTTTATACCAACCGGGCAGCAGCACAGTACTATCTGGGCAATTTTCGTTCTGCTCTCAAT
GATGTGACAGCTGCCAGAAAGCTAAAACCCTGCCACCTCAAAGCAATAATAAGAGGTGCCTTATGCCAT
CTGGAACTGAAACACTTTGCCGAGGCCGTGAACTGGTGTGATGAGGGACTGCAAATAGATGCCAAAGAG
AAGAAGCTTCTGGAAATGAGGGCTAAAGCAGACAAGCTGAAGCGAATTGAACAGAGGGATGTGAGGAAA
GCCAACTTGAAAGAAAAGAAGGAGAGGAATCAGAATGAGGCTTTACTCCAGGCCATCAAGGTCTACTTT
GAGGATGAGGACAGGGCAGAACTATACCGGGTGCCTGCCAAGAGCACCTTGCTACAGGTTCTACAGCAC
CAGAGGTACTTTGTAAAAGCCCTGACACCAGCATTTTTGGTCTGTGTAGGATCCTCTCCTTTTTGCAAG
AATTTTCTCCGGGGGAGAAAGGTGTACCAGATACGATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001291333
Insert Size 867 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001291333.1
RefSeq Size 2098 bp
RefSeq ORF 867 bp
Locus ID 7268
Cytogenetics 1p32.3
MW 33.5 kDa
Gene Summary This gene encodes a protein that contains tetratricopeptide (TPR) repeats, which often mediate protein-protein interactions and chaperone activity. The encoded protein interacts with heat shock proteins 70 and 90. Alternative splicing results in multiple transcript variants. Naturally-occuring readthrough transcription occurs from upstream gene MROH (maestro heat-like repeat family member 7) to this gene. [provided by RefSeq, Apr 2014]
Transcript Variant: This variant (2) lacks two alternate in-frame exons, compared to variant 1. The encoded isoform (2) is shorter than isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.