PGAP3 (NM_001291728) Human Untagged Clone

CAT#: SC335192

PGAP3 (untagged) - Human post-GPI attachment to proteins 3 (PGAP3), transcript variant 3


  "NM_001291728" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "PGAP3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PGAP3
Synonyms AGLA546; CAB2; hCOS16; PERLD1; PP1498
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001291728, the custom clone sequence may differ by one or more nucleotides


ATGGCCGGCCTGGCGGCGCGGTTGGTCCTGCTAGCTGGGGCAGCGGCGCTGGCGAGCGGCTCCCAGGGCG
ACCGTGAGCCGGTGTACCGCGACTGCGTACTGCAGTGCGAAGAGCAGAACTGCTCTGGGGGCGCTCTGAA
TCACTTCCGCTCCCGCCAGCCAATCTACATGAGTCTAGCAGGCTGGACCTGTCGGGACGACTGTAAGTAT
GAGTGTATGTGGGTCACCGTTGGGCTCTACCTCCAGGAAGGTCACAAAGTGCCTCAGTTCCATGGCAAGT
GGCCCTTCTCCCGGTTCCTGTTCTTTCAAGAGCCGGCATCGGCCGTGGCCTCGTTTCTCAATGGCCTGGC
CAGCCTGGTGATGCTCTGCCGCTACCGCACCTTCGTGCCAGCCTCCTCCCCCATGTACCACACCTGTGTG
GCCTTCGCCTGGAAAATGGACTACTTCTGTGCCTCCACTGTCATCCTACACTCAATCTACCTGTGCTGCG
TCAGGACCGTGGGGCTGCAGCACCCAGCTGTGGTCAGTGCCTTCCGGGCTCTCCTGCTGCTCATGCTGAC
CGTGCACGTCTCCTACCTGAGCCTCATCCGCTTCGACTATGGCTACAACCTGGTGGCCAACGTGGCTATT
GGCCTGGTCAACGTGGTGTGGTGGCTGGCCTGGTGCCTGTGGAACCAGCGGCGGCTGCCTCACGTGCGCA
AGTGCGTGGTGGTGGTCTTGCTGCTGCAGGGGCTGTCCCTGCTCGAGCTGCTTGACTTCCCACCGCTCTT
CTGGGTCCTGGATGCCCATGCCATCTGGCACATCAGCACCATCCCTGTCCACGTCCTCTTTTTCAGCTTT
CTGGAAGATGACAGCCTGTACCTGCTGAAGGAATCAGAGGACAAGTTCAAGCTGGACTGA


Restriction Sites SgfI-MluI     
ACCN NM_001291728
ORF Size 900 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001291728.1, NP_001278657.1
RefSeq Size 2658
RefSeq ORF 900
Locus ID 93210
Protein Families Transmembrane
Gene Summary This gene encodes a glycosylphosphatidylinositol (GPI)-specific phospholipase that primarily localizes to the Golgi apparatus. This ubiquitously expressed gene is predicted to encode a seven-transmembrane protein that removes unsaturated fatty acids from the sn-2 position of GPI. The remodeling of the constituent fatty acids on GPI is thought to be important for the proper association between GPI-anchored proteins and lipid rafts. The tethering of proteins to plasma membranes via posttranslational GPI-anchoring is thought to play a role in protein sorting and trafficking. Mutations in this gene cause an autosomal recessive form of neurologic hyperphosphatasia with cognitive disability (HPMRS4). Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2017]
Transcript Variant: This variant (3) lacks an in-frame exon in the 3' coding region, compared to variant 1. It encodes a shorter protein (isoform 3), compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.