RAD52 (NM_001297422) Human Untagged Clone
CAT#: SC335208
RAD52 (untagged) - Human RAD52 homolog (S. cerevisiae) (RAD52), transcript variant 5
"NM_001297422" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | RAD52 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001297422, the custom clone sequence may differ by one or more nucleotides
ATGTCTGGGACTGAGGAAGCAATTCTTGGAGGACGTGACAGCCATCCTGCTGCTGGCGGCGGCTCAGTGT TATGCTTTGGACAGTGCCAGTACACAGCAGAAGAGTACCAGGCCATCCAGAAGGCCCTGAGGCAGAGGCT GGGCCCAGAATACATAAGTAGCCGCATGGCTGGCGGAGGCCAGAAGGTGTGCTACATTGAGGGTCATCGG GTAATTAATCTGGCCAATGAGATGTTTGGTTACAATGGCTGGGCACACTCCATCACGCAGCAGAATGTGG ATTTTGTTGACCTCAACAATGGCAAGTTCTACGTGGGAGTCTGTGCATTTGTGAGGGTCCAGCTGAAGGA TGGTTCATATCATGAAGATGTTGGTTATGGTGTTAGTGAGGGCCTCAAGTCCAAGGCTTTATCTTTGGAG AAGGCAAGGAAGGAGGCGGTGACAGACGGGCTGAAGCGAGCCCTCAGGAGTTTTGGGAATGCACTTGGAA ACTGTATTCTGGACAAAGACTACCTGAGATCACTAAATAAGCTTCCACGCCAGTTGCCTCTTGAAGTGGA TTTAACTAAAGCGAAGAGACAAGATCTTGAACCGTCTGTGGAGGAGGCAAGATACAACAGCTGCCGACCG AACATGGCCCTGGGACACCCACAGCTGCAGCAGGTGACCTCCCCTTCCAGACCCAGCCATGCTGTGATAC CGGCGGACCAGGACTGCAGCTCCCGCAGCCGCGGCTGTTGCTCAGGAGCCCGTCCTCGCCGCCGCCCTCT CATGCAGAAGCCTGAGCTCATCCGCCGTGGAGAGCGAGGCCACGCACCAGCGGAAGCTCCGGCAGAAGCA GCTGCAGCAGCAGTTCCGGGAGCGGATGGAGAAGCAGCAGGTTCGAGTCTCCACGCCGTCAGCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001297422 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001297422.1, NP_001284351.1 |
RefSeq Size | 1194 bp |
RefSeq ORF | 906 bp |
Locus ID | 5893 |
Cytogenetics | 12p13.33 |
Protein Families | Druggable Genome |
Protein Pathways | Homologous recombination |
Gene Summary | 'The protein encoded by this gene shares similarity with Saccharomyces cerevisiae Rad52, a protein important for DNA double-strand break repair and homologous recombination. This gene product was shown to bind single-stranded DNA ends, and mediate the DNA-DNA interaction necessary for the annealing of complementary DNA strands. It was also found to interact with DNA recombination protein RAD51, which suggested its role in RAD51 related DNA recombination and repair. A pseudogene of this gene is present on chromosome 2. Alternative splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Jul 2014]' Transcript Variant: This variant (5) lacks several coding exons and uses an alternate 3' terminal exon, resulting in a novel 3' coding region and 3' UTR compared to variant 1. The encoded isoform (d) has a distinct C-terminus and is shorter than isoform a. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC237314 | RAD52 (myc-DDK-tagged) - Human RAD52 homolog (S. cerevisiae) (RAD52), transcript variant 5 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review