RNPS1 (NM_001286625) Human Untagged Clone

CAT#: SC335232

RNPS1 (untagged) - Human RNA binding protein S1, serine-rich domain (RNPS1), transcript variant 3


  "NM_001286625" in other vectors (1)

Reconstitution Protocol

USD 320.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "RNPS1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RNPS1
Synonyms E5.1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001286625, the custom clone sequence may differ by one or more nucleotides


ATGGATTTATCAGGAGTGAAAAAGAAGAGCTTGCTAGGAGTCAAAGAAAATAATAAAAAGTCCAGCACTA
GGGCTCCTTCACCTACCAAACGCAAAGACCGCTCAGATGAGAAGTCCAAGGATCGCTCAAAAGATAAAGG
GGCCACCAAGGAGTCGAGTGAGAAGGATCGCGGCCGGGACAAAACCCGAAAGAGGCGCAGCGCTTCCAGT
GGTAGCAGCAGTACCAGGTCTCGGTCCAGCTCGACTTCCAGCTCAGGCTCCAGCACCAGCACTGGCTCAA
GCAGTGGCTCCAGCTCTTCCTCAGCATCCAGCCGCTCAGGAAGCTCCAGCACCTCCCGCAGCTCCAGCTC
TAGCAGCTCTTCTGGCTCTCCAAGTCCTTCTCGGCGCAGACACGACAACAGGAGGCGCTCCCGCTCCAAA
TCCAAACCACCTAAAAGAGATGAAAAGGAGAGGAAAAGGCGGAGCCCATCTCCTAAGCCCACCAAAGTGC
ACATTGGGAGACTCACCCGGAATGTGACAAAGGATCACATCATGGAGATATTTTCCACCTATGGGAAAAT
TAAAATGATTGACATGCCCGTGGAAAGGATGCATCCCCATCTGTCCAAAGGCTATGCGTACGTAGAGTTT
GAGAATCCAGATGAAGCCGAGAAGGCGCTGAAGCACATGGATGGAGGACAAATTGATGGCCAGGAGATCA
CTGCCACCGCCGTGCTGGCCCCCTGGCCTAGGCCACCCCCCAGGAGATTCAGCCCTCCCAGGAGAATGTT
GCCACCACCGCCTATGTGGCGCAGGTCTCCCCCACGGATGAGGAGAAGGTCCCGCTCCCCGAGGCGCAGG
TCCCCCGTGCGCCGGAGATCACGGTCCCCGGGCCGCCGCCGCCACAGGAGCCGCTCCAGCTCCAACTCCT
CCCGATAA


Restriction Sites SgfI-MluI     
ACCN NM_001286625
ORF Size 918 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001286625.1, NP_001273554.1
RefSeq Size 2056
RefSeq ORF 918
Locus ID 10921
Protein Families Transcription Factors
Gene Summary This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein binds to the mRNA and remains bound after nuclear export, acting as a nucleocytoplasmic shuttling protein. This protein contains many serine residues. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant (2). Variants 1, 2, and 3 all encode the same isoform (a).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.