Apg3 (ATG3) (NM_001278712) Human Untagged Clone

CAT#: SC335263

ATG3 (untagged) - Human autophagy related 3 (ATG3), transcript variant 2


  "NM_001278712" in other vectors (1)

Reconstitution Protocol

USD 320.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "ATG3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ATG3
Synonyms APG3; APG3-LIKE; APG3L; PC3-96
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001278712, the custom clone sequence may differ by one or more nucleotides


ATGCAGAATGTGATTAATACTGTGAAGGGAAAGGCACTGGAAGTGGCTGAGTACCTGACCCCGGTCCTCA
AGGAATCAAAGTTTAAGGAAACAGGTGTAATTACCCCAGAAGAGTTTGTGGCAGCTGGAGATCACCTAGT
CCACCACTGTCCAACATGGCAATGGGCTACAGGGGAAGAATTGAAAGTGAAGGCATACCTACCAACAGGC
AAACAATTTTTGGTAACCAAAAATGTGCCGTGCTATAAGCGGTGCAAACAGATGGAATATTCAGATGAAT
TGGAAGCTATCATTGAAGAAGATGATGGTGATGGCGGATGGGTAGATACATATCACAACACAGGTATTAC
AGGAATAACGGAAGCCGTTAAAGAGATCACACTGGAAAATAAGGACAATATAAGGCTTCAAGATTGCTCA
GCACTATGTGAAGAGGAAGAAGATGAAGATGAAGGAGAAGCTGCAGATATGGAAGAATATGAAGAGAGTG
GATTGTTGGAAACAGATGAGGCTACCCTAGATACAAGGAAAATAGTAGAAGCTTGTAAAGCCAAAACTGA
TGCTGGCGGTGAAGATGCTATTTTGCAAACCAGAACTTATGACCTTTACATCACTTATGATAAATATTAC
CAGACTCCACGATTATGGTTGTTTGGCTATGATGAGCAACGGCAGCCTTTAACAGTTGAGCACATGTATG
AAGACATCAGTCAGGATCATGTGAAGAAAACAGTGACCATTGAAAATCACCCTCATCTGCCACCACCTCC
CATGTGTTCAGTTCACCCATGCAGGCATGCTGAGGTGATGAAGAAAATCATTGAGACTGTTGCAGAAGGA
GGGGGAGAACTTGGAGTTCATATGTATCCTTCCCTGTATGTAAGATTAGTGGCAAAATGGCTGTTAACGA
TTTTTTTTTTGAGAAATTTAGTGTAA


Restriction Sites SgfI-MluI     
ACCN NM_001278712
ORF Size 936 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001278712.1, NP_001265641.1
RefSeq Size 3060
RefSeq ORF 936
Locus ID 64422
Protein Pathways Regulation of autophagy
Gene Summary This gene encodes a ubiquitin-like-conjugating enzyme and is a component of ubiquitination-like systems involved in autophagy, the process of degradation, turnover and recycling of cytoplasmic constituents in eukaryotic cells. This protein is known to play a role in regulation of autophagy during cell death. A pseudogene of this gene is located on chromosome 20. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (2) contains a 3' terminal exon that extends past a splice site that is used in variant 1 that results in an early stop codon and a different 3' UTR, compared to variant 1. It encodes a protein which is shorter at the C-terminus (isoform 2), compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.