MAGEA2 (NM_001282505) Human Untagged Clone
CAT#: SC335281
MAGEA2 (untagged) - Human melanoma antigen family A, 2 (MAGEA2), transcript variant 7
"NM_001282505" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MAGEA2 |
Synonyms | CT1.2; MAGE2; MAGEA2A |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001282505, the custom clone sequence may differ by one or more nucleotides
ATGCCTCTTGAGCAGAGGAGTCAGCACTGCAAGCCTGAAGAAGGCCTTGAGGCCCGAGGAGAGGCCCTGG GCCTGGTGGGTGCGCAGGCTCCTGCTACTGAGGAGCAGCAGACCGCTTCTTCCTCTTCTACTCTAGTGGA AGTTACCCTGGGGGAGGTGCCTGCTGCCGACTCACCGAGTCCTCCCCACAGTCCTCAGGGAGCCTCCAGC TTCTCGACTACCATCAACTACACTCTTTGGAGACAATCCGATGAGGGCTCCAGCAACCAAGAAGAGGAGG GGCCAAGAATGTTTCCCGACCTGGAGTCCGAGTTCCAAGCAGCAATCAGTAGGAAGATGGTTGAGTTGGT TCATTTTCTGCTCCTCAAGTATCGAGCCAGGGAGCCGGTCACAAAGGCAGAAATGCTGGAGAGTGTCCTC AGAAATTGCCAGGACTTCTTTCCCGTGATCTTCAGCAAAGCCTCCGAGTACTTGCAGCTGGTCTTTGGCA TCGAGGTGGTGGAAGTGGTCCCCATCAGCCACTTGTACATCCTTGTCACCTGCCTGGGCCTCTCCTACGA TGGCCTGCTGGGCGACAATCAGGTCATGCCCAAGACAGGCCTCCTGATAATCGTCCTGGCCATAATCGCA ATAGAGGGCGACTGTGCCCCTGAGGAGAAAATCTGGGAGGAGCTGAGTATGTTGGAGGTGTTTGAGGGGA GGGAGGACAGTGTCTTCGCACATCCCAGGAAGCTGCTCATGCAAGATCTGGTGCAGGAAAACTACCTGGA GTACCGGCAGGTGCCCGGCAGTGATCCTGCATGCTACGAGTTCCTGTGGGGTCCAAGGGCCCTCATTGAA ACCAGCTATGTGAAAGTCCTGCACCATACACTAAAGATCGGTGGAGAACCTCACATTTCCTACCCACCCC TGCATGAACGGGCTTTGAGAGAGGGAGAAGAGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001282505 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001282505.1, NP_001269434.1 |
RefSeq Size | 1680 bp |
RefSeq ORF | 945 bp |
Locus ID | 4101 |
Cytogenetics | Xq28 |
Gene Summary | 'This gene is a member of the MAGEA gene family. The members of this family encode proteins with 50 to 80% sequence identity to each other. The promoters and first exons of the MAGEA genes show considerable variability, suggesting that the existence of this gene family enables the same function to be expressed under different transcriptional controls. The MAGEA genes are clustered at chromosomal location Xq28. They have been implicated in some hereditary disorders, such as dyskeratosis congenita. This gene has two identical copies at different loci. Alternatively spliced transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (7) lacks four internal exons in the 5' UTR region, compared to variant 3. Variants 1 through 7 encode the same protein. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC237387 | MAGEA2 (myc-DDK-tagged) - Human melanoma antigen family A, 2 (MAGEA2), transcript variant 7 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review