HIP55 (DBNL) (NM_001284315) Human Untagged Clone

CAT#: SC335430

DBNL (untagged) - Human drebrin-like (DBNL), transcript variant 5


  "NM_001284315" in other vectors (1)

Reconstitution Protocol

USD 340.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "DBNL"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DBNL
Synonyms ABP1; HIP-55; HIP55; SH3P7
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001284315, the custom clone sequence may differ by one or more nucleotides


ATGAAGGCAACAGCAATGACATCCGCGTGGCTGGCACAGGGGGGGGCCCATGTGACCATCAACGCACGGG
CCGAGGAGGATGTGGAGCCTGAGTGCATCATGGAGAAGGTGGCCAAGGCTTCAGGTGCCAACTACAGCTT
TCACAAGGAGAGTGGCCGCTTCCAGGACGTGGGACCCCAGGCCCCAGTGGGCTCTGTGTACCAGAAGACC
AATGCCGTGTCTGAGATTAAAAGGGTTGGTAAAGACAGCTTCTGGGCCAAAGCAGAGAAGGAGGAGGAGA
ACCGTCGGCTGGAGGAAAAGCGGCGGGCCGAGGAGGCACAGCGGCAGCTGGAGCAGGAGCGCCGGGAGCG
TGAGCTGCGTGAGGCTGCACGCCGGGAGCAGCGCTATCAGGAGCAGGGTGGCGAGGCCAGCCCCCAGAGC
AGGACGTGGGAGCAGCAGCAAGAAGTGGTTTCAAGGAACCGAAATGAGCAGGAGTCTGCCGTGCACCCGA
GGGAGATTTTCAAGCAGAAGGAGAGGGCCATGTCCACCACCTCCATCTCCAGTCCTCAGCCTGGCAAGCT
GAGGAGCCCCTTCCTGCAGAAGCAGCTCACCCAACCAGAGACCCACTTTGGCAGAGAGCCAGCTGCTGCC
ATCTCAAGGCCCAGGGCAGATCTCCCTGCTGAGGAGCCGGCGCCCAGCACTCCTCCATGTCTGGTGCAGG
CAGAAGAGGAGGCTGTGTATGAGGAACCTCCAGAGCAGGAGACCTTCTACGAGCAGCCCCCACTGGTGCA
GCAGCAAGGTGCTGGCTCTGAGCACATTGACCACCACATTCAGGGCCAGGGGCTCAGTGGGCAAGGGCTC
TGTGCCCGTGCCCTGTACGACTACCAGGCAGCCGACGACACAGAGATCTCCTTTGACCCCGAGAACCTCA
TCACGGGCATCGAGGTGATCGACGAAGGCTGGTGGCGTGGCTATGGGCCGGATGGCCATTTTGGCATGTT
CCCTGCCAACTACGTGGAGCTCATTGAGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001284315
ORF Size 1011 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001284315.1, NP_001271244.1
RefSeq Size 2025
RefSeq ORF 1011
Locus ID 28988
Gene Summary Adapter protein that binds F-actin and DNM1, and thereby plays a role in receptor-mediated endocytosis. Plays a role in the reorganization of the actin cytoskeleton, formation of cell projections, such as neurites, in neuron morphogenesis and synapse formation via its interaction with WASL and COBL. Does not bind G-actin and promote actin polymerization by itself. Required for the formation of organized podosome rosettes (By similarity). May act as a common effector of antigen receptor-signaling pathways in leukocytes. Acts as a key component of the immunological synapse that regulates T-cell activation by bridging TCRs and the actin cytoskeleton to gene activation and endocytic processes. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (5) lacks two exons and initiates translation at a downstream start codon compared to variant 1. The encoded isoform (e) has a shorter N-terminus compared to isoform c. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.