Dematin (DMTN) (NM_001302817) Human Untagged Clone

CAT#: SC335634

DMTN (untagged) - Human dematin actin binding protein (DMTN), transcript variant 8


  "NM_001302817" in other vectors (1)

Reconstitution Protocol

USD 370.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "DMTN"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DMTN
Synonyms DMT; EPB49
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001302817, the custom clone sequence may differ by one or more nucleotides


ATGGAACGGCTGCAGAAGGCCAAGATGGACAATCAGGTGCTGGGCTACAAGGACCTGGCTGCCATCCCCA
AGGACAAGGCCATCCTGGACATCGAGCGGCCCGACCTCATGATCTACGAGCCTCACTTCACTTATTCCCT
CCTGGAACACGTGGAGCTGCCTCGCAGCCGCGAGGTGTGGGCGGACAGCCGGTCGCCTGGAATCATCTCT
CAGGCCTCGGCCCCCAGAACCACTGGAACCCCCCGGACCAGCCTGCCCCATTTCCACCACCCTGAGACCT
CCCGCCCAGATTCCAACATCTACAAGAAGCCTCCCATCTATAAGCAGAGAGAGTCCGTGGGAGGCAGCCC
TCAGACCAAGCACCTCATCGAGGATCTCATCATCGAGTCATCCAAGTTTCCTGCAGCCCAGCCCCCAGAC
CCCAACCAGCCAGCCAAAATCGAAACCGACTACTGGCCATGCCCCCCGTCTCTGGCTGTTGTGGAGACAG
AATGGAGGAAGCGGAAGGCGTCTCGGAGGGGAGCAGAGGAAGAGGAGGAGGAGGAAGATGACGACTCTGG
AGAGGAGATGAAGGCTCTCAGGGAGCGTCAGAGAGAGGAACTCAGTAAGGTTACTTCCAACTTGGGAAAG
ATGATCTTGAAAGAAGAGATGGAAAAGTCATTGCCGATCCGAAGGAAAACCCGCTCTCTGCCTGACCGGA
CACCCTTCCATACCTCCTTGCACCAGGGAACGTCTAAATCTTCCTCTCTCCCCGCCTATGGCAGGACCAC
CCTGAGCCGGCTACAGTCCACAGAGTTCAGCCCATCAGGGAGTGAGACTGGAAGCCCAGGCCTGCAGAAC
GGAGAGGGCCAGAGGGGGAGGATGGACCGGGGGAACTCCCTGCCCTGTGTGCTGGAGCAGAAGATCTATC
CCTATGAAATGCTAGTGGTGACCAACAAGGGGCGAACCAAGCTGCCACCGGGGGTGGATCGGATGCGGCT
TGAGAGGCATCTGTCTGCCGAGGACTTCTCAAGGGTATTTGCCATGTCCCCTGAAGAGTTTGGCAAGCTG
GCTCTGTGGAAGCGGAATGAGCTCAAGAAGAAGGCCTCTCTCTTCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001302817
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001302817.2, NP_001289746.1
RefSeq Size 2539 bp
RefSeq ORF 1098 bp
Locus ID 2039
Cytogenetics 8p21.3
Gene Summary 'The protein encoded by this gene is an actin binding and bundling protein that plays a structural role in erythrocytes, by stabilizing and attaching the spectrin/actin cytoskeleton to the erythrocyte membrane in a phosphorylation-dependent manner. This protein contains a core domain in the N-terminus, and a headpiece domain in the C-terminus that binds F-actin. When purified from erythrocytes, this protein exists as a trimer composed of two 48 kDa polypeptides and a 52 kDa polypeptide. The different subunits arise from alternative splicing in the 3' coding region, where the headpiece domain is located. Disruption of this gene has been correlated with the autosomal dominant Marie Unna hereditary hypotrichosis disease, while loss of heterozygosity of this gene is thought to play a role in prostate cancer progression. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2014]'
Transcript Variant: This variant (8) lacks two alternate in-frame exons in the 5' coding region, compared to variant 1. Variants 8 and 18 encode the same isoform (4), which is shorter than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.