KLF5 (NM_001286818) Human Untagged Clone

CAT#: SC335638

KLF5 (untagged) - Human Kruppel-like factor 5 (intestinal) (KLF5), transcript variant 2


  "NM_001286818" in other vectors (1)

Reconstitution Protocol

USD 370.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "KLF5"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol KLF5
Synonyms BTEB2; CKLF; IKLF
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001286818, the custom clone sequence may differ by one or more nucleotides


ATGGAGAAGTATCTGACACCTCAGCTTCCTCCAGTTCCTATAATTCCAGAGCATAAAAAGTATAGACGAG
ACAGTGCCTCAGTCGTAGACCAGTTCTTCACTGACACTGAAGGGTTACCTTACAGTATCAACATGAACGT
CTTCCTCCCTGACATCACTCACCTGAGAACTGGCCTCTACAAATCCCAGAGACCGTGCGTAACACACATC
AAGACAGAACCTGTTGCCATTTTCAGCCACCAGAGTGAAACGACTGCCCCTCCTCCGGCCCCGACCCAGG
CCCTCCCTGAGTTCACCAGTATATTCAGCTCACACCAGACCGCAGCTCCAGAGGTGAACAATATTTTCAT
CAAACAAGAACTTCCTACACCAGATCTTCATCTTTCTGTCCCTACCCAGCAGGGCCACCTGTACCAGCTA
CTGAATACACCGGATCTAGATATGCCCAGTTCTACAAATCAGACAGCAGCAATGGACACTCTTAATGTTT
CTATGTCAGCTGCCATGGCAGGCCTTAACACACACACCTCTGCTGTTCCGCAGACTGCAGTGAAACAATT
CCAGGGCATGCCCCCTTGCACATACACAATGCCAAGTCAGTTTCTTCCACAACAGGCCACTTACTTTCCC
CCGTCACCACCAAGCTCAGAGCCTGGAAGTCCAGATAGACAAGCAGAGATGCTCCAGAATTTAACCCCAC
CTCCATCCTATGCTGCTACAATTGCTTCTAAACTGGCAATTCACAATCCAAATTTACCCACCACCCTGCC
AGTTAACTCACAAAACATCCAACCTGTCAGATACAATAGAAGGAGTAACCCCGATTTGGAGAAACGACGC
ATCCACTACTGCGATTACCCTGGTTGCACAAAAGTTTATACCAAGTCTTCTCATTTAAAAGCTCACCTGA
GGACTCACACTGGTGAAAAGCCATACAAGTGTACCTGGGAAGGCTGCGACTGGAGGTTCGCGCGATCGGA
TGAGCTGACCCGCCACTACCGGAAGCACACAGGCGCCAAGCCCTTCCAGTGCGGGGTGTGCAACCGCAGC
TTCTCGCGCTCTGACCACCTGGCCCTGCATATGAAGAGGCACCAGAACTGA


Restriction Sites SgfI-MluI     
ACCN NM_001286818
ORF Size 1101 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001286818.1, NP_001273747.1
RefSeq Size 2969
RefSeq ORF 1101
Locus ID 688
Protein Families Embryonic stem cells, ES Cell Differentiation/IPS, Induced pluripotent stem cells, Transcription Factors
Gene Summary This gene encodes a member of the Kruppel-like factor subfamily of zinc finger proteins. The encoded protein is a transcriptional activator that binds directly to a specific recognition motif in the promoters of target genes. This protein acts downstream of multiple different signaling pathways and is regulated by post-translational modification. It may participate in both promoting and suppressing cell proliferation. Expression of this gene may be changed in a variety of different cancers and in cardiovascular disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]
Transcript Variant: This variant (2, also known as tKLF5) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.