STK3 (NM_001256313) Human Untagged Clone

CAT#: SC335757

STK3 (untagged) - Human serine/threonine kinase 3 (STK3), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: STK3
• Synonyms: KRS1; MST2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001256313, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAGCAGCCGCCGGCGCCTAAGAGTAAACTAAAAAAGCTGAGTGAAGACAGTTTGACTAAGCAGCCTG
  AAGAAGTTTTTGATGTATTAGAGAAGCTTGGAGAAGGGTCTTATGGAAGTGTATTTAAAGCAATACACAA
  GGAATCCGGTCAAGTTGTCGCAATTAAACAAGTACCTGTTGAATCAGATCTTCAGGAAATAATCAAAGAA
  ATTTCCATAATGCAGCAATGTGACAGCCCATATGTTGTAAAGTACTATGGCAGTTATTTTAAGAATACAG
  ACCTCTGGATTGTTATGGAGTACTGTGGCGCTGGCTCTGTCTCAGACATAATTAGATTACGAAACAAGAC
  AGCTATTTTTATGATTCCCACAAATCCACCACCAACATTCAGAAAGCCAGAACTTTGGTCCGATGATTTC
  ACCGATTTTGTTAAAAAGTGTTTGGTGAAGAATCCTGAGCAGAGAGCTACTGCAACACAACTTTTACAGC
  ATCCTTTTATCAAGAATGCCAAACCTGTATCAATATTAAGAGACCTGATCACAGAAGCTATGGAGATCAA
  AGCTAAAAGACATGAGGAACAGCAACGAGAATTGGAAGAGGAAGAAGAAAATTCGGATGAAGATGAGCTG
  GATTCCCACACCATGGTGAAGACTAGTGTGGAGAGTGTGGGCACCATGCGGGCCACAAGCACGATGAGTG
  AAGGGGCCCAGACCATGATTGAACATAATAGCACGATGTTGGAATCCGACTTGGGGACCATGGTGATAAA
  CAGTGAGGATGAGGAAGAAGAAGATGGAACTATGAAAAGAAATGCAACCTCACCACAAGTACAAAGACCA
  TCTTTCATGGACTACTTTGATAAGCAAGACTTCAAGAATAAGAGTCACGAAAACTGTAATCAGAACATGC
  ATGAACCCTTCCCTATGTCCAAAAACGTTTTTCCTGATAACTGGAAAGTTCCTCAAGATGGAGACTTTGA
  CTTTTTGAAAAATCTAAGTTTAGAAGAACTACAGATGCGGTTAAAAGCACTGGACCCCATGATGGAACGG
  GAGATAGAAGAACTTCGTCAGAGATACACTGCGAAAAGACAGCCCATTCTGGATGCGATGGATGCAAAGA
  AAAGAAGGCAGCAAAACTTTTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001256313
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001256313.1, NP_001243242.1
• RefSeq Size: 2485 bp
• RefSeq ORF: 1143 bp
• Locus ID: 6788
• Cytogenetics: 8q22.2
• Protein Families: Druggable Genome, Protein Kinase
• Protein Pathways: MAPK signaling pathway
• Gene Summary: 'This gene encodes a serine/threonine protein kinase activated by proapoptotic molecules indicating the encoded protein functions as a growth suppressor. Cleavage of the protein product by caspase removes the inhibitory C-terminal portion. The N-terminal portion is transported to the nucleus where it homodimerizes to form the active kinase which promotes the condensation of chromatin during apoptosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]'
  Transcript Variant: This variant (3) lacks an alternate in-frame exon compared to variant 1. The resulting protein (isoform 2) is shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.