CD105 (ENG) (NM_001278138) Human Untagged Clone

CAT#: SC336340

ENG (untagged) - Human endoglin (ENG), transcript variant 3


  "NM_001278138" in other vectors (1)

Reconstitution Protocol

USD 480.00

2 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ENG
Synonyms END; HHT1; ORW1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001278138, the custom clone sequence may differ by one or more nucleotides


ATGCTGGAAGCCAGCCAGGACATGGGCCGCACGCTCGAGTGGCGGCCGCGTACTCCAGCCTTGGTCCGGG
GCTGCCACTTGGAAGGCGTGGCCGGCCACAAGGAGGCGCACATCCTGAGGGTCCTGCCGGGCCACTCGGC
CGGGCCCCGGACGGTGACGGTGAAGGTGGAACTGAGCTGCGCACCCGGGGATCTCGATGCCGTCCTCATC
CTGCAGGGTCCCCCCTACGTGTCCTGGCTCATCGACGCCAACCACAACATGCAGATCTGGACCACTGGAG
AATACTCCTTCAAGATCTTTCCAGAGAAAAACATTCGTGGCTTCAAGCTCCCAGACACACCTCAAGGCCT
CCTGGGGGAGGCCCGGATGCTCAATGCCAGCATTGTGGCATCCTTCGTGGAGCTACCGCTGGCCAGCATT
GTCTCACTTCATGCCTCCAGCTGCGGTGGTAGGCTGCAGACCTCACCCGCACCGATCCAGACCACTCCTC
CCAAGGACACTTGTAGCCCGGAGCTGCTCATGTCCTTGATCCAGACAAAGTGTGCCGACGACGCCATGAC
CCTGGTACTAAAGAAAGAGCTTGTTGCGCATTTGAAGTGCACCATCACGGGCCTGACCTTCTGGGACCCC
AGCTGTGAGGCAGAGGACAGGGGTGACAAGTTTGTCTTGCGCAGTGCTTACTCCAGCTGTGGCATGCAGG
TGTCAGCAAGTATGATCAGCAATGAGGCGGTGGTCAATATCCTGTCGAGCTCATCACCACAGCGGAAAAA
GGTGCACTGCCTCAACATGGACAGCCTCTCTTTCCAGCTGGGCCTCTACCTCAGCCCACACTTCCTCCAG
GCCTCCAACACCATCGAGCCGGGGCAGCAGAGCTTTGTGCAGGTCAGAGTGTCCCCATCCGTCTCCGAGT
TCCTGCTCCAGTTAGACAGCTGCCACCTGGACTTGGGGCCTGAGGGAGGCACCGTGGAACTCATCCAGGG
CCGGGCGGCCAAGGGCAACTGTGTGAGCCTGCTGTCCCCAAGCCCCGAGGGTGACCCGCGCTTCAGCTTC
CTCCTCCACTTCTACACAGTACCCATACCCAAAACCGGCACCCTCAGCTGCACGGTAGCCCTGCGTCCCA
AGACCGGGTCTCAAGACCAGGAAGTCCATAGGACTGTCTTCATGCGCTTGAACATCATCAGCCCTGACCT
GTCTGGTTGCACAAGCAAAGGCCTCGTCCTGCCCGCCGTGCTGGGCATCACCTTTGGTGCCTTCCTCATC
GGGGCCCTGCTCACTGCTGCACTCTGGTACATCTACTCGCACACGCGTTCCCCCAGCAAGCGGGAGCCCG
TGGTGGCGGTGGCTGCCCCGGCCTCCTCGGAGAGCAGCAGCACCAACCACAGCATCGGGAGCACCCAGAG
CACCCCCTGCTCCACCAGCAGCATGGCATAG


Restriction Sites SgfI-RsrII     
ACCN NM_001278138
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001278138.1, NP_001265067.1
RefSeq Size 2817 bp
RefSeq ORF 1431 bp
Locus ID 2022
Cytogenetics 9q34.11
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Transmembrane
Gene Summary 'This gene encodes a homodimeric transmembrane protein which is a major glycoprotein of the vascular endothelium. This protein is a component of the transforming growth factor beta receptor complex and it binds to the beta1 and beta3 peptides with high affinity. Mutations in this gene cause hereditary hemorrhagic telangiectasia, also known as Osler-Rendu-Weber syndrome 1, an autosomal dominant multisystemic vascular dysplasia. This gene may also be involved in preeclampsia and several types of cancer. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2013]'
Transcript Variant: This variant (3) contains a distinct 5' UTR, lacks a portion of the 5' coding region, and uses a downstream in-frame start codon, compared to variant 1. The encoded isoform (3) has a shorter N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.