Bestrophin (BEST1) (NM_001300786) Human Untagged Clone

CAT#: SC336469

BEST1 (untagged) - Human bestrophin 1 (BEST1), transcript variant 3


  "NM_001300786" in other vectors (1)

Reconstitution Protocol

USD 500.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "BEST1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol BEST1
Synonyms ARB; BEST; Best1V1Delta2; BMD; RP50; TU15B; VMD2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001300786, the custom clone sequence may differ by one or more nucleotides


ATGTTTGAGAAACTGACTCTGTATTGCGACAGCTACATCCAGCTCATCCCCATTTCCTTCGTGCTGGGCT
TCTACGTGACGCTGGTCGTGACCCGCTGGTGGAACCAGTACGAGAACCTGCCGTGGCCCGACCGCCTCAT
GAGCCTGGTGTCGGGCTTCGTCGAAGGCAAGGACGAGCAAGGCCGGCTGCTGCGGCGCACGCTCATCCGC
TACGCCAACCTGGGCAACGTGCTCATCCTGCGCAGCGTCAGCACCGCAGTCTACAAGCGCTTCCCCAGCG
CCCAGCACCTGGTGCAAGCAGGCTTTATGACTCCGGCAGAACACAAGCAGTTGGAGAAACTGAGCCTACC
ACACAACATGTTCTGGGTGCCCTGGGTGTGGTTTGCCAACCTGTCAATGAAGGCGTGGCTTGGAGGTCGA
ATCCGGGACCCTATCCTGCTCCAGAGCCTGCTGAACGAGATGAACACCTTGCGTACTCAGTGTGGACACC
TGTATGCCTACGACTGGATTAGTATCCCACTGGTGTATACACAGGTGGTGACTGTGGCGGTGTACAGCTT
CTTCCTGACTTGTCTAGTTGGGCGGCAGTTTCTGAACCCAGCCAAGGCCTACCCTGGCCATGAGCTGGAC
CTCGTTGTGCCCGTCTTCACGTTCCTGCAGTTCTTCTTCTATGTTGGCTGGCTGAAGGTGTCCCTGTTGG
CTGTGGATGAGATGCACCAGGACCTGCCTCGGATGGAGCCGGACATGTACTGGAATAAGCCCGAGCCACA
GCCCCCCTACACAGCTGCTTCCGCCCAGTTCCGTCGAGCCTCCTTTATGGGCTCCACCTTCAACATCAGC
CTGAACAAAGAGGAGATGGAGTTCCAGCCCAATCAGGAGGACGAGGAGGATGCTCACGCTGGCATCATTG
GCCGCTTCCTAGGCCTGCAGTCCCATGATCACCATCCTCCCAGGGCAAACTCAAGGACCAAACTACTGTG
GCCCAAGAGGGAATCCCTTCTCCACGAGGGCCTGCCCAAAAACCACAAGGCAGCCAAACAGAACGTTAGG
GGCCAGGAAGACAACAAGGCCTGGAAGCTTAAGGCTGTGGACGCCTTCAAGTCTGCCCCACTGTATCAGA
GGCCAGGCTACTACAGTGCCCCACAGACGCCCCTCAGCCCCACTCCCATGTTCTTCCCCCTAGAACCATC
AGCGCCGTCAAAGCTTCACAGTGTCACAGGCATAGACACCAAAGACAAAAGCTTAAAGACTGTGAGTTCT
GGGGCCAAGAAAAGTTTTGAATTGCTCTCAGAGAGCGATGGGGCCTTGATGGAGCACCCAGAAGTATCTC
AAGTGAGGAGGAAAACTGTGGAGTTTAACCTGACGGATATGCCAGAGATCCCCGAAAATCACCTCAAAGA
ACCTTTGGAACAATCACCAACCAACATACACACTACACTCAAAGATCACATGGATCCTTATTGGGCCTTG
GAAAACAGGGATGAAGCACATTCCTAA


Restriction Sites SgfI-MluI     
ACCN NM_001300786
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001300786.1, NP_001287715.1
RefSeq Size 2421 bp
RefSeq ORF 1497 bp
Locus ID 7439
Cytogenetics 11q12.3
Protein Families Druggable Genome, Ion Channels: Other, Transmembrane
Gene Summary 'This gene encodes a member of the bestrophin gene family. This small gene family is characterized by proteins with a highly conserved N-terminus with four to six transmembrane domains. Bestrophins may form chloride ion channels or may regulate voltage-gated L-type calcium-ion channels. Bestrophins are generally believed to form calcium-activated chloride-ion channels in epithelial cells but they have also been shown to be highly permeable to bicarbonate ion transport in retinal tissue. Mutations in this gene are responsible for juvenile-onset vitelliform macular dystrophy (VMD2), also known as Best macular dystrophy, in addition to adult-onset vitelliform macular dystrophy (AVMD) and other retinopathies. Alternative splicing results in multiple variants encoding distinct isoforms.[provided by RefSeq, Nov 2008]'
Transcript Variant: This variant (3) lacks an alternate in-frame exon and differs in the 3' UTR and coding sequence compared to variant 2. The resulting isoform (3) lacks an alternate internal segment and has a shorter and distinct C-terminus compared to isoform 2.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.