2K protein (NC_001563) Virus Tagged ORF Clone
CAT#: VC102512
- TrueORF®
Myc-DDK-tagged ORF clone of viral ORF for unnamed protein product [West Nile virus], codon optimized for human cell expression, NP_776020
View other clones from "Virus" (11)
Product Images
Specifications
Product Data | |
Type | Virus Tagged ORF Clone |
Tag | Myc-DDK |
Symbol | 2K protein |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>The Viral ORF clone VC102512 represents NCBI reference of NP_776020 with codon optimized for human cell expression
Red=Cloning site Blue=ORF Green=Tags(s) GACGTTGTATACGACTCCTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCACAGACTGACAACCAGCTGGCCGTGTTCCTCATCTGTGTGCTCACTCTCGTCGGCGCCGTTGCTG CC ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA >VC102512 representing NP_776020
Red=Cloning sites Green=Tags MSQTDNQLAVFLICVLTLVGAVAA TRTRRLEQKLISEEDLAANDILDYKDDDDKV |
Restriction Sites | SgfI-MluI Cloning Scheme for this gene |
ACCN | NC_001563 |
ORF Size | 72 bp |
OTI Disclaimer | The molecular sequence of this clone can be viewed by clicking the "ORF Nucleotide Sequence" link above. This sequence represents the NCBI reference after codon optimization for human cell expression, and retaining the same decuded protein sequence. The stop codon in the native sequence was removed to create the in-frame c-terminal fusion with a Myc-DDK tag. |
Reference Data | |
RefSeq | NC_001563.2, NP_776020 |
RefSeq ORF | 72 |
MW | 2.5 kDa |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
VC102502 | Myc-DDK-tagged ORF clone of viral ORF for unnamed protein product [West Nile virus], codon optimized for human cell expression, NP_776010 |
USD 400.00 |
|
VC102503 | Myc-DDK-tagged ORF clone of viral ORF for unnamed protein product [West Nile virus], codon optimized for human cell expression, NP_776011 |
USD 400.00 |
|
VC102504 | Myc-DDK-tagged ORF clone of viral ORF for unnamed protein product [West Nile virus], codon optimized for human cell expression, NP_776012 |
USD 400.00 |
|
VC102505 | Myc-DDK-tagged ORF clone of viral ORF for unnamed protein product [West Nile virus], codon optimized for human cell expression, NP_776013 |
USD 400.00 |
|
VC102506 | Myc-DDK-tagged ORF clone of viral ORF for unnamed protein product [West Nile virus], codon optimized for human cell expression, NP_776014 |
USD 640.00 |
|
VC102507 | Myc-DDK-tagged ORF clone of viral ORF for unnamed protein product [West Nile virus], codon optimized for human cell expression, NP_776015 |
USD 440.00 |
|
VC102508 | Myc-DDK-tagged ORF clone of viral ORF for unnamed protein product [West Nile virus], codon optimized for human cell expression, NP_776016 |
USD 400.00 |
|
VC102509 | Myc-DDK-tagged ORF clone of viral ORF for unnamed protein product [West Nile virus], codon optimized for human cell expression, NP_776017 |
USD 400.00 |
|
VC102510 | Myc-DDK-tagged ORF clone of viral ORF for unnamed protein product [West Nile virus], codon optimized for human cell expression, NP_776018 |
USD 780.00 |
|
VC102511 | Myc-DDK-tagged ORF clone of viral ORF for unnamed protein product [West Nile virus], codon optimized for human cell expression, NP_776019 |
USD 400.00 |
|
VC102513 | Myc-DDK-tagged ORF clone of viral ORF for unnamed protein product [West Nile virus], codon optimized for human cell expression, NP_776021 |
USD 400.00 |
{0} Product Review(s)
Be the first one to submit a review