Cryaa (BC092385) Mouse Untagged Clone

CAT#: MC206827

Cryaa (untagged) - Mouse crystallin, alpha A (cDNA clone MGC:106604 IMAGE:30602480), (10ug)


  "BC092385" in other vectors (4)

Reconstitution Protocol

USD 340.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Cryaa"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Cryaa
Synonyms Acry-1|Crya-1|Crya1|DAcry-1|lop18
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC092385
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACGTCACCATTCAGCATCCTTGGTTCAAGCGTGCCCTGGGGCCCTTCTACCCCAGCCGACTGTTCG
ACCAGTTCTTCGGCGAGGGCCTTTTTGAGTACGACCTGCTGCCCTTCCTGTCTTCCACCATCAGCCCCTA
CTACCGCCAGTCCCTCTTCCGCACTGTGCTGGACTCGGGCATCTCTGAGGTCCGATCTGACCGGGACAAG
TTTGTCATCTTCTTGGACGTGAAGCACTTCTCTCCTGAGGACCTCACCGTGAAGGTACTGGAGGATTTTG
TGGAGATTCACGGCAAACACAACGAGAGGCAGGATGACCATGGCTACATTTCCCGTGAATTTCACCGTCG
CTACCGTCTGCCTTCCAATGTGGACCAGTCCGCCCTCTCCTGCTCCCTGTCTGCGGATGGCATGCTGACC
TTCTCTGGCCCCAAGGTCCAGTCCGGTTTGGATGCTGGCCACAGCGAGAGGGCCATTCCTGTGTCACGGG
AGGAGAAACCCAGCTCTGCACCCTCGTCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-MluI     
ACCN BC092385
ORF Size 522 bp
Insert Size 522
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC092385, AAH92385
RefSeq Size 1112
RefSeq ORF 521
Locus ID 12954
Gene Summary This gene encodes subunit a, one of two subunits of alpha-crystallin, which is a high molecular weight, soluble aggregate and is a member of the small heat shock protein (sHSP) family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. It acts as a molecular chaperone and is the major protein in the eye lens, maintaining the transparency and refractive index of the lens. In mouse, deficiency in this gene is associated with smaller lenses and eyes and with increasing lens opacity with age. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.