Fxyd3 (BC002039) Mouse Untagged Clone

CAT#: MC206839

Fxyd3 (untagged) - Mouse FXYD domain-containing ion transport regulator 3 (cDNA clone MGC:6001 IMAGE:3488180), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Fxyd3
• Synonyms: Mat8
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC002039
  Red=Cloning site Blue=ORF Green=Tags(s)
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCAAGAGGTTGTTCTGAGCCTGTTGGTCCTTCTAGCAGGCCTGCCTACTTTGGATGCCAATGACCCTG
  AAAATAAAAATGATCCTTTCTACTATGATTGGTACAGCCTCCGAGTCGGCGGGCTCATTTGTGCAGGGAT
  TCTCTGTGCCCTGGGCATTATAGTCCTTATGAGTGGCAAATGCAAATGCAAGTTCAGACAGAAACCCAGT
  CACCGCCCAGGAGAAGGGCCACCTCTCATCACACCAGGCTCAGCTCACAACTGCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: BC002039
• ORF Size: 267 bp
• Insert Size: 267
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: BC002039, AAH02039
• RefSeq Size: 503
• RefSeq ORF: 266
• Locus ID: 17178
• Gene Summary: This gene encodes a member of a family of small membrane proteins that share a 35-amino acid signature sequence domain, beginning with the sequence PFXYD and containing 7 invariant and 6 highly conserved amino acids. The encoded protein is a transmembrane protein that functions as a specific regulator of Na,K-ATPase. [provided by RefSeq, Aug 2009]