Cartpt (BC056431) Mouse Untagged Clone

CAT#: MC206869

Cartpt (untagged) - Mouse CART prepropeptide (cDNA clone MGC:66635 IMAGE:6817832), (10ug)


  "BC056431" in other vectors (4)

Reconstitution Protocol

USD 340.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Cartpt"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Cartpt
Synonyms Cart
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC056431
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGAGCTCCCGCCTGCGGCTGCTACCCCTCCTGGGCGCCGCCCTGCTGCTACTGCTACCTTTGCTGG
GTGCCCGTGCCCAGGAGGACGCCGAGCTGCAGCCCCGAGCCCTGGACATCTACTCTGCCGTGGATGATGC
GTCCCACGAGAAGGAGCTGCCAAGGCGGCAACTTCGGGCTCCCGGCGCTATGTTGCAGATCGAAGCGTTG
CAAGAAGTCCTGAAGAAGCTCAAGAGTAAACGCATTCCGATCTACGAGAAGAAGTACGGCCAAGTCCCCA
TGTGTGACGCTGGAGAGCAGTGCGCAGTGAGGAAAGGGGCCAGGATCGGGAAGCTGTGTGACTGTCCCCG
AGGAACTTCCTGCAATTCTTTCCTCTTGAAGTGCTTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-MluI     
ACCN BC056431
ORF Size 390 bp
Insert Size 390
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC056431, AAH56431
RefSeq Size 607
RefSeq ORF 389
Locus ID 27220
Gene Summary This gene encodes preproprotein isoforms that are processed into multiple biologically active peptides. Expression of this gene is regulated by cocaine and other drugs, and is associated with feeding/appetite and stress response. Mice lacking the encoded protein are predisposed to obesity. Deficiency of the encoded protein in mice results in pancreatic islet dysfunction, impaired insulin secretion and glucose intolerance. Alternative splicing results in multiple transcript variants encoding different isoforms, which are subsequently processed into mature peptides. [provided by RefSeq, Jul 2015]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.