Fxyd6 (BC042579) Mouse Untagged Clone

CAT#: MC206885

Fxyd6 (untagged) - Mouse FXYD domain-containing ion transport regulator 6 (cDNA clone MGC:25545 IMAGE:3709336), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Fxyd6
• Synonyms: Php
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC042579
  Red=Cloning site Blue=ORF Green=Tags(s)
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGAGACGGTGCTGGTCCTCTGCAGCTTGCTGGCCCCTGTGGTCCTGGCGAGTGCAGCTGAGAAGGAGA
  AAGAAAAGGATCCTTTCTATTACGACTACCAGACCCTGAGGATTGGGGGGTTGGTGTTTGCTGTGGTCCT
  CTTCTCCGTTGGGATACTTCTCATCCTCAGTCGCAGATGCAAGTGCAGTTTCAATCAGAAGCCCAGGGCT
  CCAGGTGACGAAGAGGCCCAGGTGGAGAACCTCATCACTACAAACGCTGCAGAGCCCCAGAAGGCAGAGA
  ACTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: BC042579
• ORF Size: 285 bp
• Insert Size: 285
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: BC042579, AAH42579
• RefSeq Size: 1600
• RefSeq ORF: 284
• Locus ID: 59095
• Gene Summary: This reference sequence was derived from multiple replicate ESTs and validated by similar human genomic sequence. This gene encodes a member of a family of small membrane proteins that share a 35-amino acid signature sequence domain, beginning with the sequence PFXYD and containing 7 invariant and 6 highly conserved amino acids. The approved human gene nomenclature for the family is FXYD-domain containing ion transport regulator. Transmembrane topology has been established for two family members (FXYD1 and FXYD2), with the N-terminus extracellular and the C-terminus on the cytoplasmic side of the membrane. FXYD2, also known as the gamma subunit of the Na,K-ATPase, regulates the properties of that enzyme. FXYD1 (phospholemman), FXYD2 (gamma), FXYD3 (MAT-8), FXYD4 (CHIF), and FXYD5 (RIC) have been shown to induce channel activity in experimental expression systems. This gene product, Fxyd6, is novel and has not been characterized as a protein. [RefSeq curation by Kathleen J. Sweadner, Ph.D., sweadner@helix.mgh.harvard.edu., Jul 2006]