MGC73635 (BC062251) Mouse Untagged Clone

CAT#: MC207006

MGC73635 (untagged) - Mouse similar to histone 2a (cDNA clone MGC:73635 IMAGE:1224905), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: MGC73635
• Synonyms: ENSMUSG00000060262|Gm11276|OTTMUSG00000000448
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC062251
  Red=Cloning site Blue=ORF Green=Tags(s)
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTCTGGACGCGGCAAGCAGGGTGGCAAGGCTCGCGCCAAGGCCAAGACCCGCTCCTCCCGGGCCGGCC
  TGCAGTTCCCCGTGGGCCGCGTGCACCGGCTGCTCCGCAAGGGCAACTACTCGGAGCGCGTGGGCGCCGG
  CGCCCCGGTCTACCTGGCGGCCGTGCTGGAGTACCTGACGGCCGAGATCCTGGAGCTGGCGGGCAACGCG
  GCCCGCGACAACAAGAAGACGCGCATCATCCCGCGCCACCTGCAGCTGGCCATCCGCAACGACGAGGAGC
  TCAACAAGCTGCTGGGCCGCGTGACCATCGCGCAGGGCGGCGTCCTGCCCAACATCCAGGCCGTGCTGCT
  GCCCAAGAAGACCGAGAGCCACCACAAGGCCAAGGGAAAATAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: BC062251
• ORF Size: 393 bp
• Insert Size: 393
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: BC062251, AAH62251
• RefSeq Size: 444
• RefSeq ORF: 392
• Locus ID: 665433
• Gene Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. This structure consists of approximately 146 bp of DNA wrapped around a nucleosome, an octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2A family. Transcripts from this gene lack polyA tails; instead, they contain a palindromic termination element. [provided by RefSeq, Aug 2015]