Eif5a (NM_001166596) Mouse Untagged Clone

CAT#: MC207032

Eif5a (untagged) - Mouse eukaryotic translation initiation factor 5A (Eif5a), transcript variant 9, (10ug)


  "NM_001166596" in other vectors (4)

Reconstitution Protocol

USD 340.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Eif5a"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Eif5a
Synonyms AA410058; D19Wsu54e; eIF-4D; eIF-5A; eIF-5A-1; eIF-5A1; Eif4d; Eif5a1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207032 representing NM_001166596
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAGATGATTTGGACTTCGAGACAGGAGATGCAGGGGCCTCAGCCACCTTCCCAATGCAGTGCTCAG
CATTACGTAAGAATGGTTTTGTGGTGCTCAAAGGCCGGCCATGTAAGATCGTCGAGATGTCTACTTCGAA
GACTGGCAAGCATGGCCATGCCAAGGTCCATCTGGTTGGCATTGACATTTTTACTGGGAAGAAATATGAA
GATATCTGCCCGTCAACTCATAATATGGATGTCCCCAACATCAAACGGAATGACTTCCAGCTGATTGGCA
TCCAGGATGGGTACCTATCCCTGCTCCAGGACAGTGGGGAGGTACGAGAGGACCTTCGTCTGCCTGAAGG
AGACCTTGGCAAGGAGATTGAGCAGAAGTATGACTGTGGAGAAGAGATCCTGATCACAGTGCTGTCTGCC
ATGACAGAGGAGGCAGCTGTTGCAATCAAGGCCATGGCAAAATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001166596
ORF Size 465 bp
Insert Size 465
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001166596.1, NP_001160068.1
RefSeq Size 1293
RefSeq ORF 465
Locus ID 276770
Gene Summary This gene encodes an elongation initiation factor, which participates in protein synthesis. The encoded protein also plays roles in mRNA metabolism, cell proliferation, and cell cycle control. This protein contains a modified lysine residue called hypusine, which appears to be necessary for its function. Alternatively spliced transcript variants have been described. Related pseudogenes exist on chromosomes 2, 5, and 19. [provided by RefSeq, Oct 2009]
Transcript Variant: This variant (9) differs in the 5' UTR compared to variant 1. Variants 1-9 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.