Hist2h2aa1 (BC010564) Mouse Untagged Clone

CAT#: MC207057

Hist2h2aa1 (untagged) - Mouse histone cluster 2, H2aa1 (cDNA clone MGC:5956 IMAGE:3582122), (10ug)


  "BC010564" in other vectors (4)

Reconstitution Protocol

USD 340.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Hist2h2aa1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Hist2h2aa1
Synonyms H2a-615
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC010564
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCCGGTCGTGGCAAGCAAGGAGGCAAGGCCCGCGCCAAGGCCAAGTCGCGGTCTTCCCGGGCCGGGC
TACAGTTCCCGGTGGGGCGTGTACACCGGCTGCTGCGCAAGGGCAACTACGCGGAGCGTGTGGGCGCCGG
CGCGCCGGTATACATGGCGGCGGTGCTGGAGTACCTAACGGCCGAGATCCTGGAGCTGGCGGGCAACGCG
GCCCGCGACAACAAGAAGACGCGCATCATCCCGCGCCACCTGCAGCTGGCCATCCGCAACGACGAGGAGC
TCAACAAGCTGCTGGGCAAAGTGACGATCGCGCAGGGCGGCGTCCTGCCCAACATCCAGGCCGTGCTGCT
GCCCAAGAAGACGGAGAGCCACCATAAGGCGAAGGGCAAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-MluI     
ACCN BC010564
ORF Size 393 bp
Insert Size 393
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC010564, AAH10564
RefSeq Size 543
RefSeq ORF 392
Locus ID 15267
Gene Summary Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2A family. [provided by RefSeq, Oct 2015]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.