D930016D06Rik (BC023132) Mouse Untagged Clone

CAT#: MC207158

D930016D06Rik (untagged) - Mouse RIKEN cDNA D930016D06 gene (cDNA clone MGC:27898 IMAGE:3499319), (10ug)


  "BC023132" in other vectors (4)

Reconstitution Protocol

USD 340.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "D930016D06Rik"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol D930016D06Rik
Synonyms 1110004B06Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC023132
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTCAGTGGGTAAGAGCACCCGACTGCTCTTCCGAAGGTCTGGAGTTCAAATCCCAGCAACCACATG
GTGGCTCACAACCATCTGTAACAAGATCTGACGCCCTCTTCTGGAGTGTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-MluI     
ACCN BC023132
ORF Size 1923 bp
Insert Size 1923
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC023132
RefSeq Size 2426
RefSeq ORF 122
Locus ID 100662

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.