EG627860 (BC059104) Mouse Untagged Clone

CAT#: MC207204

EG627860 (untagged) - Mouse predicted gene, EG627860 (cDNA clone MGC:70303 IMAGE:5125942), (10ug)


  "BC059104" in other vectors (4)

Reconstitution Protocol

USD 340.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "EG627860"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol EG627860
Synonyms EG627860|Gm6800
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC059104
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAGACCAGGTCTGCATGCCCTTCACCAATGCTGTCATTCATGAGGGCATGACTCTCATCTCCAACC
TGTTCCGTGCTGAAGGATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-MluI     
ACCN BC059104
ORF Size 465 bp
Insert Size 465
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC059104
RefSeq Size 684
RefSeq ORF 89
Locus ID 100038515

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.